FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639941_at:

>probe:Drosophila_2:1639941_at:653:593; Interrogation_Position=161; Antisense; TGGGCCAACGTTATCGACTGGTCAC
>probe:Drosophila_2:1639941_at:360:407; Interrogation_Position=176; Antisense; GACTGGTCACGGGTTCCAATCAAGT
>probe:Drosophila_2:1639941_at:361:239; Interrogation_Position=193; Antisense; AATCAAGTTGCCACATTTGCGCTTC
>probe:Drosophila_2:1639941_at:190:669; Interrogation_Position=215; Antisense; TTCTTTCGGTGTGCCACGATGTTTA
>probe:Drosophila_2:1639941_at:515:441; Interrogation_Position=232; Antisense; GATGTTTACCGTAGCCTGCAGGACA
>probe:Drosophila_2:1639941_at:582:295; Interrogation_Position=263; Antisense; CGAAACTGGTTTCCGAGCTAGGGCA
>probe:Drosophila_2:1639941_at:570:95; Interrogation_Position=287; Antisense; AGATATCCGCCCAAGTAACTGACTT
>probe:Drosophila_2:1639941_at:691:431; Interrogation_Position=319; Antisense; GAGTGCCTGCACCTATGTAATGAGC
>probe:Drosophila_2:1639941_at:221:37; Interrogation_Position=443; Antisense; ATCTTAGTCAGCTGCAACCCAAGTT
>probe:Drosophila_2:1639941_at:664:365; Interrogation_Position=478; Antisense; GAATCCTCGTTGGAGTCCTTCAAAT
>probe:Drosophila_2:1639941_at:405:377; Interrogation_Position=529; Antisense; GAAGCACGCATTACCCTTGGATTGG
>probe:Drosophila_2:1639941_at:619:425; Interrogation_Position=562; Antisense; GAGAGACTGTCCAGTTTTCCGCTGA
>probe:Drosophila_2:1639941_at:277:349; Interrogation_Position=63; Antisense; GCAGTTAAAGCATTTGGCCACCACC
>probe:Drosophila_2:1639941_at:329:37; Interrogation_Position=98; Antisense; ATCTATGCCTTAAGTCTGCGACGAC

Paste this into a BLAST search page for me
TGGGCCAACGTTATCGACTGGTCACGACTGGTCACGGGTTCCAATCAAGTAATCAAGTTGCCACATTTGCGCTTCTTCTTTCGGTGTGCCACGATGTTTAGATGTTTACCGTAGCCTGCAGGACACGAAACTGGTTTCCGAGCTAGGGCAAGATATCCGCCCAAGTAACTGACTTGAGTGCCTGCACCTATGTAATGAGCATCTTAGTCAGCTGCAACCCAAGTTGAATCCTCGTTGGAGTCCTTCAAATGAAGCACGCATTACCCTTGGATTGGGAGAGACTGTCCAGTTTTCCGCTGAGCAGTTAAAGCATTTGGCCACCACCATCTATGCCTTAAGTCTGCGACGAC

Full Affymetrix probeset data:

Annotations for 1639941_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720