FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639944_at:

>probe:Drosophila_2:1639944_at:115:527; Interrogation_Position=1256; Antisense; GGGCAAAGAACTGACCTATGAGGCA
>probe:Drosophila_2:1639944_at:137:15; Interrogation_Position=1281; Antisense; ATTATGGGCATGAAGTATCTGGATC
>probe:Drosophila_2:1639944_at:599:331; Interrogation_Position=1338; Antisense; GCGGCAATTGCCGTCGATCGAGAAT
>probe:Drosophila_2:1639944_at:711:53; Interrogation_Position=1361; Antisense; ATGCAACAAGGATATCACCTTCGAT
>probe:Drosophila_2:1639944_at:303:69; Interrogation_Position=1390; Antisense; ATGGCCAGAAAGTCGAGGTCAAGAA
>probe:Drosophila_2:1639944_at:472:221; Interrogation_Position=1413; Antisense; AAGGGCGATGTCATCTGGCTGCCTA
>probe:Drosophila_2:1639944_at:719:315; Interrogation_Position=1433; Antisense; GCCTACATGCGGCTTCCATCGTGAT
>probe:Drosophila_2:1639944_at:600:421; Interrogation_Position=1470; Antisense; GAGAACCCTATGAAGTTCGATCCGG
>probe:Drosophila_2:1639944_at:353:713; Interrogation_Position=1485; Antisense; TTCGATCCGGAACGTTTTAGCGATG
>probe:Drosophila_2:1639944_at:580:549; Interrogation_Position=1517; Antisense; GGAGTCTATTCAGCCATTCACATAC
>probe:Drosophila_2:1639944_at:726:11; Interrogation_Position=1532; Antisense; ATTCACATACTTCCCCTTTGGCCTG
>probe:Drosophila_2:1639944_at:653:689; Interrogation_Position=1548; Antisense; TTTGGCCTGGGTCAACGCAACTGCA
>probe:Drosophila_2:1639944_at:539:199; Interrogation_Position=1561; Antisense; AACGCAACTGCATTGGTTCCCGATT
>probe:Drosophila_2:1639944_at:723:629; Interrogation_Position=1578; Antisense; TCCCGATTCGCTCTACTTGAAGCAA

Paste this into a BLAST search page for me
GGGCAAAGAACTGACCTATGAGGCAATTATGGGCATGAAGTATCTGGATCGCGGCAATTGCCGTCGATCGAGAATATGCAACAAGGATATCACCTTCGATATGGCCAGAAAGTCGAGGTCAAGAAAAGGGCGATGTCATCTGGCTGCCTAGCCTACATGCGGCTTCCATCGTGATGAGAACCCTATGAAGTTCGATCCGGTTCGATCCGGAACGTTTTAGCGATGGGAGTCTATTCAGCCATTCACATACATTCACATACTTCCCCTTTGGCCTGTTTGGCCTGGGTCAACGCAACTGCAAACGCAACTGCATTGGTTCCCGATTTCCCGATTCGCTCTACTTGAAGCAA

Full Affymetrix probeset data:

Annotations for 1639944_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720