FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639946_at:

>probe:Drosophila_2:1639946_at:125:161; Interrogation_Position=1031; Antisense; ACAAGCTGCACGATCCGCTGGTGGA
>probe:Drosophila_2:1639946_at:441:587; Interrogation_Position=1052; Antisense; TGGAGCCGGGCAGTGCTGATCTCAC
>probe:Drosophila_2:1639946_at:28:39; Interrogation_Position=1070; Antisense; ATCTCACGGCCGATGTGGACTTCAA
>probe:Drosophila_2:1639946_at:482:557; Interrogation_Position=1086; Antisense; GGACTTCAAGCTAGTGCGGCACATT
>probe:Drosophila_2:1639946_at:379:567; Interrogation_Position=1103; Antisense; GGCACATTGCCGAGACACGCGGAAA
>probe:Drosophila_2:1639946_at:143:553; Interrogation_Position=1194; Antisense; GGAGCAACTGTTGGCACATGCGCTG
>probe:Drosophila_2:1639946_at:522:427; Interrogation_Position=1231; Antisense; GAGATCATTCGCTCCGGCTACGAGA
>probe:Drosophila_2:1639946_at:529:569; Interrogation_Position=1246; Antisense; GGCTACGAGATGCTCACGGATCCAG
>probe:Drosophila_2:1639946_at:511:63; Interrogation_Position=1276; Antisense; ATGGGCACTCGCTTTAAGTTCCTGG
>probe:Drosophila_2:1639946_at:90:673; Interrogation_Position=1331; Antisense; TAGACAAATACCCAGTCGTCGGATT
>probe:Drosophila_2:1639946_at:465:477; Interrogation_Position=850; Antisense; GTTTCGAGTCTTTATCGACCGCTGC
>probe:Drosophila_2:1639946_at:98:107; Interrogation_Position=881; Antisense; AGACACGATCCTGTTTGGAGCACTC
>probe:Drosophila_2:1639946_at:394:199; Interrogation_Position=917; Antisense; AACGACAGGTGGGACTGCTCGCCGA
>probe:Drosophila_2:1639946_at:25:333; Interrogation_Position=959; Antisense; GCGGCATCGCTCTAATCATGGATTA

Paste this into a BLAST search page for me
ACAAGCTGCACGATCCGCTGGTGGATGGAGCCGGGCAGTGCTGATCTCACATCTCACGGCCGATGTGGACTTCAAGGACTTCAAGCTAGTGCGGCACATTGGCACATTGCCGAGACACGCGGAAAGGAGCAACTGTTGGCACATGCGCTGGAGATCATTCGCTCCGGCTACGAGAGGCTACGAGATGCTCACGGATCCAGATGGGCACTCGCTTTAAGTTCCTGGTAGACAAATACCCAGTCGTCGGATTGTTTCGAGTCTTTATCGACCGCTGCAGACACGATCCTGTTTGGAGCACTCAACGACAGGTGGGACTGCTCGCCGAGCGGCATCGCTCTAATCATGGATTA

Full Affymetrix probeset data:

Annotations for 1639946_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720