Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639949_s_at:

>probe:Drosophila_2:1639949_s_at:561:77; Interrogation_Position=402; Antisense; AGAAGACCGGTGAGTTCTTCCGTCT
>probe:Drosophila_2:1639949_s_at:627:259; Interrogation_Position=512; Antisense; CAGCTGGGAGCCAAGGGAGTTCCTT
>probe:Drosophila_2:1639949_s_at:423:427; Interrogation_Position=528; Antisense; GAGTTCCTTTCCTGGTTACACACGA
>probe:Drosophila_2:1639949_s_at:548:133; Interrogation_Position=588; Antisense; ACGCCAACGATTCCGTGCAGGTGGA
>probe:Drosophila_2:1639949_s_at:473:349; Interrogation_Position=604; Antisense; GCAGGTGGACATTGCCTCTGGCAAG
>probe:Drosophila_2:1639949_s_at:327:641; Interrogation_Position=620; Antisense; TCTGGCAAGATCACCGACTACATTA
>probe:Drosophila_2:1639949_s_at:382:657; Interrogation_Position=643; Antisense; TAAGTTCGATTCTGGCAACCTCTGC
>probe:Drosophila_2:1639949_s_at:72:349; Interrogation_Position=666; Antisense; GCATGATCACCGGAGGCAGGAATTT
>probe:Drosophila_2:1639949_s_at:137:245; Interrogation_Position=685; Antisense; GAATTTGGGACGTGTCGGCACCGTT
>probe:Drosophila_2:1639949_s_at:706:541; Interrogation_Position=731; Antisense; GGTTCCTTCGACATTGTGCACATTA
>probe:Drosophila_2:1639949_s_at:464:405; Interrogation_Position=758; Antisense; GACTCGCAAGGTCATGTGTTCGCCA
>probe:Drosophila_2:1639949_s_at:16:199; Interrogation_Position=794; Antisense; AACGTGTTCATCATTGGCAAGGGCA
>probe:Drosophila_2:1639949_s_at:365:211; Interrogation_Position=899; Antisense; AAGACCCACTAAGGCGCAGGAGTTT
>probe:Drosophila_2:1639949_s_at:200:187; Interrogation_Position=946; Antisense; AACACTCTGTACGTTTAGCTACGGA

Paste this into a BLAST search page for me
AGAAGACCGGTGAGTTCTTCCGTCTCAGCTGGGAGCCAAGGGAGTTCCTTGAGTTCCTTTCCTGGTTACACACGAACGCCAACGATTCCGTGCAGGTGGAGCAGGTGGACATTGCCTCTGGCAAGTCTGGCAAGATCACCGACTACATTATAAGTTCGATTCTGGCAACCTCTGCGCATGATCACCGGAGGCAGGAATTTGAATTTGGGACGTGTCGGCACCGTTGGTTCCTTCGACATTGTGCACATTAGACTCGCAAGGTCATGTGTTCGCCAAACGTGTTCATCATTGGCAAGGGCAAAGACCCACTAAGGCGCAGGAGTTTAACACTCTGTACGTTTAGCTACGGA

Full Affymetrix probeset data:

Annotations for 1639949_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime