Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639950_at:

>probe:Drosophila_2:1639950_at:150:495; Interrogation_Position=1380; Antisense; GTCAACCTCATAATACTTTCTGGCA
>probe:Drosophila_2:1639950_at:174:641; Interrogation_Position=1398; Antisense; TCTGGCATTTTCCATTGCGCATTTT
>probe:Drosophila_2:1639950_at:684:5; Interrogation_Position=1411; Antisense; ATTGCGCATTTTACTGGATTTTGAT
>probe:Drosophila_2:1639950_at:178:191; Interrogation_Position=1436; Antisense; AACATTTGCTATTCCATAACTGACA
>probe:Drosophila_2:1639950_at:137:19; Interrogation_Position=1488; Antisense; ATTTGCATTGCATATCTGGAATACA
>probe:Drosophila_2:1639950_at:371:413; Interrogation_Position=1513; Antisense; GAGCCTTTTCGATATGGTTTTCCTA
>probe:Drosophila_2:1639950_at:269:629; Interrogation_Position=1533; Antisense; TCCTATCCTATGGTGGCAGTTTCTA
>probe:Drosophila_2:1639950_at:150:17; Interrogation_Position=1630; Antisense; ATTTATTGAACAGCACTCGCTCCGG
>probe:Drosophila_2:1639950_at:55:281; Interrogation_Position=1645; Antisense; CTCGCTCCGGTATTTTTGACAGCAC
>probe:Drosophila_2:1639950_at:157:399; Interrogation_Position=1662; Antisense; GACAGCACTGATAAGGCAACTCTAA
>probe:Drosophila_2:1639950_at:395:355; Interrogation_Position=1693; Antisense; GCACGTAGCATTTTCTGTCGTCTAA
>probe:Drosophila_2:1639950_at:603:705; Interrogation_Position=1810; Antisense; TTAGAGATCTGGCTTCTGTGCAAGA
>probe:Drosophila_2:1639950_at:348:365; Interrogation_Position=1847; Antisense; GAATAGCTCCTAGGACATGTATTTA
>probe:Drosophila_2:1639950_at:77:703; Interrogation_Position=1912; Antisense; TTATTTTAATGCTCGCTTGTCTGCG

Paste this into a BLAST search page for me
GTCAACCTCATAATACTTTCTGGCATCTGGCATTTTCCATTGCGCATTTTATTGCGCATTTTACTGGATTTTGATAACATTTGCTATTCCATAACTGACAATTTGCATTGCATATCTGGAATACAGAGCCTTTTCGATATGGTTTTCCTATCCTATCCTATGGTGGCAGTTTCTAATTTATTGAACAGCACTCGCTCCGGCTCGCTCCGGTATTTTTGACAGCACGACAGCACTGATAAGGCAACTCTAAGCACGTAGCATTTTCTGTCGTCTAATTAGAGATCTGGCTTCTGTGCAAGAGAATAGCTCCTAGGACATGTATTTATTATTTTAATGCTCGCTTGTCTGCG

Full Affymetrix probeset data:

Annotations for 1639950_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime