Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639951_at:

>probe:Drosophila_2:1639951_at:394:263; Interrogation_Position=131; Antisense; CAGCAGGCTCCGGAGAGTACATCAA
>probe:Drosophila_2:1639951_at:336:87; Interrogation_Position=164; Antisense; AGTCCCAATGCGAGACCGATGGATT
>probe:Drosophila_2:1639951_at:4:155; Interrogation_Position=198; Antisense; ACAGTGGACGGAACCGGCGATGCCA
>probe:Drosophila_2:1639951_at:377:49; Interrogation_Position=217; Antisense; ATGCCAGGTCCAGTGCCTTGGAAGA
>probe:Drosophila_2:1639951_at:695:35; Interrogation_Position=250; Antisense; ATCATTCTTTTGCTGTTTATCGGTG
>probe:Drosophila_2:1639951_at:513:41; Interrogation_Position=268; Antisense; ATCGGTGGCATTGTTTGCATCGCCT
>probe:Drosophila_2:1639951_at:576:315; Interrogation_Position=289; Antisense; GCCTTTGCCACCTTAAACTGGGTGA
>probe:Drosophila_2:1639951_at:267:713; Interrogation_Position=376; Antisense; TTCATCCCGGGAAGCTACTATGTGT
>probe:Drosophila_2:1639951_at:656:679; Interrogation_Position=394; Antisense; TATGTGTACGTGCTCTTCTGCATAA
>probe:Drosophila_2:1639951_at:544:641; Interrogation_Position=410; Antisense; TCTGCATAATGCTCAACCGCAACGG
>probe:Drosophila_2:1639951_at:424:131; Interrogation_Position=425; Antisense; ACCGCAACGGATTCACCATGGACGA
>probe:Drosophila_2:1639951_at:89:477; Interrogation_Position=530; Antisense; GTTATTCACACATTTCATTGGCATA
>probe:Drosophila_2:1639951_at:20:457; Interrogation_Position=592; Antisense; GATACATGTGTATTGCCCCGGTAAT
>probe:Drosophila_2:1639951_at:204:25; Interrogation_Position=68; Antisense; ATATGGAGCCCACCAATTCGGAGTC

Paste this into a BLAST search page for me
CAGCAGGCTCCGGAGAGTACATCAAAGTCCCAATGCGAGACCGATGGATTACAGTGGACGGAACCGGCGATGCCAATGCCAGGTCCAGTGCCTTGGAAGAATCATTCTTTTGCTGTTTATCGGTGATCGGTGGCATTGTTTGCATCGCCTGCCTTTGCCACCTTAAACTGGGTGATTCATCCCGGGAAGCTACTATGTGTTATGTGTACGTGCTCTTCTGCATAATCTGCATAATGCTCAACCGCAACGGACCGCAACGGATTCACCATGGACGAGTTATTCACACATTTCATTGGCATAGATACATGTGTATTGCCCCGGTAATATATGGAGCCCACCAATTCGGAGTC

Full Affymetrix probeset data:

Annotations for 1639951_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime