FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639952_at:

>probe:Drosophila_2:1639952_at:502:491; Interrogation_Position=1134; Antisense; GTACAATTGCATTAGCTCGGCGGTG
>probe:Drosophila_2:1639952_at:534:549; Interrogation_Position=1158; Antisense; GGAGGTATCCAAGATCTCGCACGAT
>probe:Drosophila_2:1639952_at:451:685; Interrogation_Position=1214; Antisense; TATCAGACACAGAGGCGGGCACGGA
>probe:Drosophila_2:1639952_at:2:561; Interrogation_Position=1246; Antisense; GGAAAGCCGAGCACCGACACCGAGA
>probe:Drosophila_2:1639952_at:245:625; Interrogation_Position=1318; Antisense; TGCGCCTCGCTCTATGTCATGATGA
>probe:Drosophila_2:1639952_at:337:497; Interrogation_Position=1333; Antisense; GTCATGATGACCCTGACCAACTGGT
>probe:Drosophila_2:1639952_at:270:483; Interrogation_Position=1355; Antisense; GGTACAAACCTCATTCGGAAATCGA
>probe:Drosophila_2:1639952_at:424:395; Interrogation_Position=1372; Antisense; GAAATCGAGCTGTTCAACGGCAACG
>probe:Drosophila_2:1639952_at:88:567; Interrogation_Position=1390; Antisense; GGCAACGAGGCTTCCATGTGGGTCA
>probe:Drosophila_2:1639952_at:165:593; Interrogation_Position=1408; Antisense; TGGGTCAAGATCGTCTCCAGTTGGC
>probe:Drosophila_2:1639952_at:7:309; Interrogation_Position=1424; Antisense; CCAGTTGGCTGGGTGTCTTCATCTA
>probe:Drosophila_2:1639952_at:674:513; Interrogation_Position=1436; Antisense; GTGTCTTCATCTATGGCTGGAGCCT
>probe:Drosophila_2:1639952_at:13:603; Interrogation_Position=1473; Antisense; TGTTCTTACCAATCGCGACTTTAGC
>probe:Drosophila_2:1639952_at:336:403; Interrogation_Position=1621; Antisense; GACTCTACATGTGGTGTCTACTCAT

Paste this into a BLAST search page for me
GTACAATTGCATTAGCTCGGCGGTGGGAGGTATCCAAGATCTCGCACGATTATCAGACACAGAGGCGGGCACGGAGGAAAGCCGAGCACCGACACCGAGATGCGCCTCGCTCTATGTCATGATGAGTCATGATGACCCTGACCAACTGGTGGTACAAACCTCATTCGGAAATCGAGAAATCGAGCTGTTCAACGGCAACGGGCAACGAGGCTTCCATGTGGGTCATGGGTCAAGATCGTCTCCAGTTGGCCCAGTTGGCTGGGTGTCTTCATCTAGTGTCTTCATCTATGGCTGGAGCCTTGTTCTTACCAATCGCGACTTTAGCGACTCTACATGTGGTGTCTACTCAT

Full Affymetrix probeset data:

Annotations for 1639952_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720