FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639954_at:

>probe:Drosophila_2:1639954_at:694:159; Interrogation_Position=181; Antisense; ACAAGAGCGATTTATCCCTGGACAA
>probe:Drosophila_2:1639954_at:54:123; Interrogation_Position=261; Antisense; AGCGACAAGTTCAGCGGCTTCATTC
>probe:Drosophila_2:1639954_at:94:65; Interrogation_Position=288; Antisense; ATGGACCGACTGGAGATCACCTACA
>probe:Drosophila_2:1639954_at:362:411; Interrogation_Position=325; Antisense; GACCCGGTGGTCAGCACGTGAACAC
>probe:Drosophila_2:1639954_at:663:547; Interrogation_Position=365; Antisense; GGATGTACGCTTCAAGGTGGCACAA
>probe:Drosophila_2:1639954_at:614:121; Interrogation_Position=389; Antisense; AGCGGACTGGATACCCGAGCAGACG
>probe:Drosophila_2:1639954_at:376:103; Interrogation_Position=409; Antisense; AGACGCGCCAGAAGCTGCTCAAGGT
>probe:Drosophila_2:1639954_at:446:79; Interrogation_Position=430; Antisense; AGGTGCTGGCAAACCGGATTACCAA
>probe:Drosophila_2:1639954_at:92:211; Interrogation_Position=454; Antisense; AAGACGGCTACTTTTACATCAAGAG
>probe:Drosophila_2:1639954_at:616:33; Interrogation_Position=471; Antisense; ATCAAGAGTGATCTTACGCGCTCCC
>probe:Drosophila_2:1639954_at:466:55; Interrogation_Position=501; Antisense; ATGAACCTGGCCGATGCGCTGGAGA
>probe:Drosophila_2:1639954_at:89:537; Interrogation_Position=620; Antisense; GGTCCGCGAACGTCTACAACTGAAA
>probe:Drosophila_2:1639954_at:588:193; Interrogation_Position=637; Antisense; AACTGAAACGTGGTCGCGCCCAAGT
>probe:Drosophila_2:1639954_at:306:413; Interrogation_Position=679; Antisense; GACCGAGCGGATTAGACTTGTAGTT

Paste this into a BLAST search page for me
ACAAGAGCGATTTATCCCTGGACAAAGCGACAAGTTCAGCGGCTTCATTCATGGACCGACTGGAGATCACCTACAGACCCGGTGGTCAGCACGTGAACACGGATGTACGCTTCAAGGTGGCACAAAGCGGACTGGATACCCGAGCAGACGAGACGCGCCAGAAGCTGCTCAAGGTAGGTGCTGGCAAACCGGATTACCAAAAGACGGCTACTTTTACATCAAGAGATCAAGAGTGATCTTACGCGCTCCCATGAACCTGGCCGATGCGCTGGAGAGGTCCGCGAACGTCTACAACTGAAAAACTGAAACGTGGTCGCGCCCAAGTGACCGAGCGGATTAGACTTGTAGTT

Full Affymetrix probeset data:

Annotations for 1639954_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720