Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639955_at:

>probe:Drosophila_2:1639955_at:323:695; Interrogation_Position=2395; Antisense; TTTCCTGTGCAATAACTGCGGCAAG
>probe:Drosophila_2:1639955_at:620:721; Interrogation_Position=2428; Antisense; TTGCATCTCCAACTTGCAGGCACAT
>probe:Drosophila_2:1639955_at:342:357; Interrogation_Position=2447; Antisense; GCACATCGCAAGGTGCATGCCGATA
>probe:Drosophila_2:1639955_at:138:333; Interrogation_Position=2475; Antisense; GCGGCCAGTTGCCTTTGAATGCCAA
>probe:Drosophila_2:1639955_at:518:329; Interrogation_Position=2517; Antisense; GCGTGCAGCGCGGAAAACTCTTGAT
>probe:Drosophila_2:1639955_at:157:181; Interrogation_Position=2530; Antisense; AAAACTCTTGATGGGCGCTAAGCCG
>probe:Drosophila_2:1639955_at:612:75; Interrogation_Position=2574; Antisense; AGGAGACCAAGACCTTGATCGCCCA
>probe:Drosophila_2:1639955_at:449:725; Interrogation_Position=2588; Antisense; TTGATCGCCCAGGATGTCATCGACA
>probe:Drosophila_2:1639955_at:679:49; Interrogation_Position=2618; Antisense; ATGCCCATGGCACAGGAGCTCAACT
>probe:Drosophila_2:1639955_at:600:591; Interrogation_Position=2703; Antisense; TGGTGCCACACATCGTACTGCAGAC
>probe:Drosophila_2:1639955_at:106:439; Interrogation_Position=2738; Antisense; GAGGCCCGGCGAATGGAGTAACTTC
>probe:Drosophila_2:1639955_at:684:385; Interrogation_Position=2764; Antisense; GAACACATTCATTTAGCGATCCCAC
>probe:Drosophila_2:1639955_at:313:197; Interrogation_Position=2809; Antisense; AACGGATGCGTATTCTACTGTACAA
>probe:Drosophila_2:1639955_at:550:695; Interrogation_Position=2934; Antisense; TTTAACGCCATACGGACCTGTCAAA

Paste this into a BLAST search page for me
TTTCCTGTGCAATAACTGCGGCAAGTTGCATCTCCAACTTGCAGGCACATGCACATCGCAAGGTGCATGCCGATAGCGGCCAGTTGCCTTTGAATGCCAAGCGTGCAGCGCGGAAAACTCTTGATAAAACTCTTGATGGGCGCTAAGCCGAGGAGACCAAGACCTTGATCGCCCATTGATCGCCCAGGATGTCATCGACAATGCCCATGGCACAGGAGCTCAACTTGGTGCCACACATCGTACTGCAGACGAGGCCCGGCGAATGGAGTAACTTCGAACACATTCATTTAGCGATCCCACAACGGATGCGTATTCTACTGTACAATTTAACGCCATACGGACCTGTCAAA

Full Affymetrix probeset data:

Annotations for 1639955_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime