FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639956_at:

>probe:Drosophila_2:1639956_at:407:477; Interrogation_Position=1064; Antisense; GTTTTCATGGTTTCAACACTCGTCC
>probe:Drosophila_2:1639956_at:308:259; Interrogation_Position=1080; Antisense; CACTCGTCCGTTATTCTGTTTCTAA
>probe:Drosophila_2:1639956_at:93:727; Interrogation_Position=1134; Antisense; TTGTCAACGCATTTGGCAGACTATT
>probe:Drosophila_2:1639956_at:675:223; Interrogation_Position=1191; Antisense; AAGGCGGCCCGAGAATTCATATTGT
>probe:Drosophila_2:1639956_at:158:491; Interrogation_Position=1214; Antisense; GTACATGTTTACTAGCGTGAATCCT
>probe:Drosophila_2:1639956_at:268:511; Interrogation_Position=1230; Antisense; GTGAATCCTGATCCTTACAAGTGCA
>probe:Drosophila_2:1639956_at:24:665; Interrogation_Position=1245; Antisense; TACAAGTGCATCTATCCTCATTTCA
>probe:Drosophila_2:1639956_at:629:305; Interrogation_Position=1260; Antisense; CCTCATTTCACCGTTGCTACAAATA
>probe:Drosophila_2:1639956_at:368:471; Interrogation_Position=1298; Antisense; GTTCGTGTTCACTGCTGTCAAGGAC
>probe:Drosophila_2:1639956_at:261:391; Interrogation_Position=1347; Antisense; GAAACTAATTTGCTGTGACCTCGAT
>probe:Drosophila_2:1639956_at:439:331; Interrogation_Position=1358; Antisense; GCTGTGACCTCGATTTCTACAAAAT
>probe:Drosophila_2:1639956_at:23:659; Interrogation_Position=886; Antisense; TAAGATTGGTGGACGTCGCTGGTCA
>probe:Drosophila_2:1639956_at:452:721; Interrogation_Position=969; Antisense; TTGGTTGCCATGTCCGAGTTTGATC
>probe:Drosophila_2:1639956_at:566:429; Interrogation_Position=984; Antisense; GAGTTTGATCTATCCTTGGCTGAAT

Paste this into a BLAST search page for me
GTTTTCATGGTTTCAACACTCGTCCCACTCGTCCGTTATTCTGTTTCTAATTGTCAACGCATTTGGCAGACTATTAAGGCGGCCCGAGAATTCATATTGTGTACATGTTTACTAGCGTGAATCCTGTGAATCCTGATCCTTACAAGTGCATACAAGTGCATCTATCCTCATTTCACCTCATTTCACCGTTGCTACAAATAGTTCGTGTTCACTGCTGTCAAGGACGAAACTAATTTGCTGTGACCTCGATGCTGTGACCTCGATTTCTACAAAATTAAGATTGGTGGACGTCGCTGGTCATTGGTTGCCATGTCCGAGTTTGATCGAGTTTGATCTATCCTTGGCTGAAT

Full Affymetrix probeset data:

Annotations for 1639956_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720