Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639957_s_at:

>probe:Drosophila_2:1639957_s_at:359:243; Interrogation_Position=130; Antisense; AATATGGTACCCGTTATGGTGCCTC
>probe:Drosophila_2:1639957_s_at:153:317; Interrogation_Position=150; Antisense; GCCTCCCTGCGTAAGATGGTCAAGA
>probe:Drosophila_2:1639957_s_at:177:559; Interrogation_Position=179; Antisense; GGAAATCACCCAGCACAGCAAGTAC
>probe:Drosophila_2:1639957_s_at:211:219; Interrogation_Position=198; Antisense; AAGTACACTTGCTCCTTCTGCGGCA
>probe:Drosophila_2:1639957_s_at:171:225; Interrogation_Position=222; Antisense; AAGGACTCCATGAAGCGCGCCGTTG
>probe:Drosophila_2:1639957_s_at:689:39; Interrogation_Position=252; Antisense; ATCTGGTCCTGCAAGCGCTGCAAAA
>probe:Drosophila_2:1639957_s_at:654:301; Interrogation_Position=341; Antisense; CCGTCGTCTGCGTGAAACCAAGGAA
>probe:Drosophila_2:1639957_s_at:264:653; Interrogation_Position=403; Antisense; TAATTGAATGCTCCGCTATGCTAGC
>probe:Drosophila_2:1639957_s_at:318:341; Interrogation_Position=422; Antisense; GCTAGCTCCCGTAGTTTTAATCTGA
>probe:Drosophila_2:1639957_s_at:441:39; Interrogation_Position=441; Antisense; ATCTGACAACGCGATTTTCCTGTGG
>probe:Drosophila_2:1639957_s_at:77:461; Interrogation_Position=453; Antisense; GATTTTCCTGTGGTTTGCGCCGTGC
>probe:Drosophila_2:1639957_s_at:436:323; Interrogation_Position=469; Antisense; GCGCCGTGCCGGTCATGTGAAAATA
>probe:Drosophila_2:1639957_s_at:330:231; Interrogation_Position=613; Antisense; AATGATACTTCTGTGCACTCGTGAT
>probe:Drosophila_2:1639957_s_at:597:145; Interrogation_Position=629; Antisense; ACTCGTGATTTATGTTCTGTGTGCA

Paste this into a BLAST search page for me
AATATGGTACCCGTTATGGTGCCTCGCCTCCCTGCGTAAGATGGTCAAGAGGAAATCACCCAGCACAGCAAGTACAAGTACACTTGCTCCTTCTGCGGCAAAGGACTCCATGAAGCGCGCCGTTGATCTGGTCCTGCAAGCGCTGCAAAACCGTCGTCTGCGTGAAACCAAGGAATAATTGAATGCTCCGCTATGCTAGCGCTAGCTCCCGTAGTTTTAATCTGAATCTGACAACGCGATTTTCCTGTGGGATTTTCCTGTGGTTTGCGCCGTGCGCGCCGTGCCGGTCATGTGAAAATAAATGATACTTCTGTGCACTCGTGATACTCGTGATTTATGTTCTGTGTGCA

Full Affymetrix probeset data:

Annotations for 1639957_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime