FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639959_at:

>probe:Drosophila_2:1639959_at:450:207; Interrogation_Position=1249; Antisense; AAGCTGCCGGGTTTTCATGTGACAT
>probe:Drosophila_2:1639959_at:249:463; Interrogation_Position=1341; Antisense; GATTCCCTTTCCTGCTGTGTATGGA
>probe:Drosophila_2:1639959_at:41:529; Interrogation_Position=1412; Antisense; GGGAGCACATGAGCCTCTATTTCAA
>probe:Drosophila_2:1639959_at:144:415; Interrogation_Position=1447; Antisense; GAGCCACAGGCCATGTATGTATCCG
>probe:Drosophila_2:1639959_at:380:623; Interrogation_Position=1479; Antisense; TGCGGGAGCCTATTACAGCTATAAT
>probe:Drosophila_2:1639959_at:32:35; Interrogation_Position=1502; Antisense; ATCGGTTGACGGGATCCTTCGAGTT
>probe:Drosophila_2:1639959_at:450:511; Interrogation_Position=1582; Antisense; GTGACAACCTTCAAGAACCATCCAG
>probe:Drosophila_2:1639959_at:720:47; Interrogation_Position=1601; Antisense; ATCCAGTTCTGTTTGCCGCCAAGGG
>probe:Drosophila_2:1639959_at:342:65; Interrogation_Position=1631; Antisense; ATGGTCTATGGACCGCGCCAGGAAA
>probe:Drosophila_2:1639959_at:727:221; Interrogation_Position=1670; Antisense; AAGTGGCACGCCTGTATGATATTAA
>probe:Drosophila_2:1639959_at:321:461; Interrogation_Position=1697; Antisense; GATTCGGAACGCCATGGAACACTTG
>probe:Drosophila_2:1639959_at:62:209; Interrogation_Position=1737; Antisense; AAGCTACGAGAACCTGAGATCCTAT
>probe:Drosophila_2:1639959_at:567:19; Interrogation_Position=1771; Antisense; ATCTTTATACTTATTCCCCTCTTTG
>probe:Drosophila_2:1639959_at:586:17; Interrogation_Position=1808; Antisense; ATCTTTTCCAAAAGGTCGGTCGCTG

Paste this into a BLAST search page for me
AAGCTGCCGGGTTTTCATGTGACATGATTCCCTTTCCTGCTGTGTATGGAGGGAGCACATGAGCCTCTATTTCAAGAGCCACAGGCCATGTATGTATCCGTGCGGGAGCCTATTACAGCTATAATATCGGTTGACGGGATCCTTCGAGTTGTGACAACCTTCAAGAACCATCCAGATCCAGTTCTGTTTGCCGCCAAGGGATGGTCTATGGACCGCGCCAGGAAAAAGTGGCACGCCTGTATGATATTAAGATTCGGAACGCCATGGAACACTTGAAGCTACGAGAACCTGAGATCCTATATCTTTATACTTATTCCCCTCTTTGATCTTTTCCAAAAGGTCGGTCGCTG

Full Affymetrix probeset data:

Annotations for 1639959_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720