FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639960_at:

>probe:Drosophila_2:1639960_at:118:277; Interrogation_Position=131; Antisense; CTTCACCGGACACAAGCACGTGGAG
>probe:Drosophila_2:1639960_at:136:553; Interrogation_Position=158; Antisense; GGAGCCGTTCGCCAAGTACGAGTAC
>probe:Drosophila_2:1639960_at:297:669; Interrogation_Position=174; Antisense; TACGAGTACCTGAGGCGGCGGACCA
>probe:Drosophila_2:1639960_at:422:287; Interrogation_Position=189; Antisense; CGGCGGACCAAACGATTCCCATGGG
>probe:Drosophila_2:1639960_at:195:453; Interrogation_Position=20; Antisense; GATCTTTGATATCCGGCTTATGGGC
>probe:Drosophila_2:1639960_at:570:43; Interrogation_Position=223; Antisense; ATCGCAGTTTGTTTCACAATGCCGA
>probe:Drosophila_2:1639960_at:342:161; Interrogation_Position=238; Antisense; ACAATGCCGAGGTGAATGCCCTGCC
>probe:Drosophila_2:1639960_at:554:321; Interrogation_Position=302; Antisense; GCGCCTATTATTTTACTCTTTAACT
>probe:Drosophila_2:1639960_at:568:189; Interrogation_Position=323; Antisense; AACTTAGCTTACTACGAACTGATGG
>probe:Drosophila_2:1639960_at:539:141; Interrogation_Position=340; Antisense; ACTGATGGTAAGAAGTTCCCACTAA
>probe:Drosophila_2:1639960_at:40:343; Interrogation_Position=35; Antisense; GCTTATGGGCAATATGCCCGCCAAT
>probe:Drosophila_2:1639960_at:96:585; Interrogation_Position=366; Antisense; TGGAATGCCACCTAGATTTTTGGAT
>probe:Drosophila_2:1639960_at:526:299; Interrogation_Position=53; Antisense; CGCCAATACCGCTGGTCTGTGGAAG
>probe:Drosophila_2:1639960_at:241:591; Interrogation_Position=65; Antisense; TGGTCTGTGGAAGCGTGTCACCTTC

Paste this into a BLAST search page for me
CTTCACCGGACACAAGCACGTGGAGGGAGCCGTTCGCCAAGTACGAGTACTACGAGTACCTGAGGCGGCGGACCACGGCGGACCAAACGATTCCCATGGGGATCTTTGATATCCGGCTTATGGGCATCGCAGTTTGTTTCACAATGCCGAACAATGCCGAGGTGAATGCCCTGCCGCGCCTATTATTTTACTCTTTAACTAACTTAGCTTACTACGAACTGATGGACTGATGGTAAGAAGTTCCCACTAAGCTTATGGGCAATATGCCCGCCAATTGGAATGCCACCTAGATTTTTGGATCGCCAATACCGCTGGTCTGTGGAAGTGGTCTGTGGAAGCGTGTCACCTTC

Full Affymetrix probeset data:

Annotations for 1639960_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720