FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639961_at:

>probe:Drosophila_2:1639961_at:650:81; Interrogation_Position=1004; Antisense; AGGGCTTCTTTGTGGCTCTGTTCTA
>probe:Drosophila_2:1639961_at:711:277; Interrogation_Position=1011; Antisense; CTTTGTGGCTCTGTTCTACTGTTTC
>probe:Drosophila_2:1639961_at:350:475; Interrogation_Position=1031; Antisense; GTTTCCTTAACTCAGAGGTGCGCCA
>probe:Drosophila_2:1639961_at:21:707; Interrogation_Position=1037; Antisense; TTAACTCAGAGGTGCGCCAGACGCT
>probe:Drosophila_2:1639961_at:371:625; Interrogation_Position=1049; Antisense; TGCGCCAGACGCTGAGGCATGGATT
>probe:Drosophila_2:1639961_at:95:105; Interrogation_Position=1055; Antisense; AGACGCTGAGGCATGGATTCACCCG
>probe:Drosophila_2:1639961_at:94:285; Interrogation_Position=1060; Antisense; CTGAGGCATGGATTCACCCGGTGGC
>probe:Drosophila_2:1639961_at:189:579; Interrogation_Position=1081; Antisense; TGGCGGGAGAGCAGGAATATCCATC
>probe:Drosophila_2:1639961_at:316:365; Interrogation_Position=1095; Antisense; GAATATCCATCGGAACAGTTCCATC
>probe:Drosophila_2:1639961_at:620:639; Interrogation_Position=1104; Antisense; TCGGAACAGTTCCATCAAGAATCGC
>probe:Drosophila_2:1639961_at:96:211; Interrogation_Position=1120; Antisense; AAGAATCGCAGGTGGGCTAACCAAT
>probe:Drosophila_2:1639961_at:524:349; Interrogation_Position=1127; Antisense; GCAGGTGGGCTAACCAATCATTGAG
>probe:Drosophila_2:1639961_at:351:325; Interrogation_Position=1154; Antisense; GCGACTGCACTCATTTGGCATTCTA
>probe:Drosophila_2:1639961_at:227:645; Interrogation_Position=992; Antisense; TCATAAGCACGCAGGGCTTCTTTGT

Paste this into a BLAST search page for me
AGGGCTTCTTTGTGGCTCTGTTCTACTTTGTGGCTCTGTTCTACTGTTTCGTTTCCTTAACTCAGAGGTGCGCCATTAACTCAGAGGTGCGCCAGACGCTTGCGCCAGACGCTGAGGCATGGATTAGACGCTGAGGCATGGATTCACCCGCTGAGGCATGGATTCACCCGGTGGCTGGCGGGAGAGCAGGAATATCCATCGAATATCCATCGGAACAGTTCCATCTCGGAACAGTTCCATCAAGAATCGCAAGAATCGCAGGTGGGCTAACCAATGCAGGTGGGCTAACCAATCATTGAGGCGACTGCACTCATTTGGCATTCTATCATAAGCACGCAGGGCTTCTTTGT

Full Affymetrix probeset data:

Annotations for 1639961_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720