Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639962_a_at:

>probe:Drosophila_2:1639962_a_at:402:59; Interrogation_Position=155; Antisense; ATGTTGAGCATCACGGCCCGTAACC
>probe:Drosophila_2:1639962_a_at:221:623; Interrogation_Position=234; Antisense; TGCGCTGTCTGCACGGAACCGAGGA
>probe:Drosophila_2:1639962_a_at:86:437; Interrogation_Position=266; Antisense; GAGGAGTTCGACAAGCGCTACGAGA
>probe:Drosophila_2:1639962_a_at:650:421; Interrogation_Position=287; Antisense; GAGAAGTACTTCAGCCGTGAGGGCA
>probe:Drosophila_2:1639962_a_at:517:347; Interrogation_Position=309; Antisense; GCATCGATGGCTGGGAGATCCGCAA
>probe:Drosophila_2:1639962_a_at:604:81; Interrogation_Position=333; Antisense; AGGGCATGAACGATCTGCTGGGCAT
>probe:Drosophila_2:1639962_a_at:641:195; Interrogation_Position=416; Antisense; AACGACATTGCACTGGCCATCAGGT
>probe:Drosophila_2:1639962_a_at:705:53; Interrogation_Position=451; Antisense; ATGCAAGGACAAGTGCGGCGACCAA
>probe:Drosophila_2:1639962_a_at:302:593; Interrogation_Position=531; Antisense; TGGGCATCCCAACCATCGAGGAACT
>probe:Drosophila_2:1639962_a_at:163:245; Interrogation_Position=573; Antisense; AATTGGCCCTGAAGTCCGTGTACGA
>probe:Drosophila_2:1639962_a_at:721:487; Interrogation_Position=592; Antisense; GTACGATGCCTAAGCGGAGAACACT
>probe:Drosophila_2:1639962_a_at:581:29; Interrogation_Position=640; Antisense; ATACACGTTACAGCGACACTAGCTA
>probe:Drosophila_2:1639962_a_at:485:155; Interrogation_Position=655; Antisense; ACACTAGCTACCTACTATCCAATGT
>probe:Drosophila_2:1639962_a_at:407:7; Interrogation_Position=722; Antisense; ATTGCAGTAAGGCTACCACACCAGC

Paste this into a BLAST search page for me
ATGTTGAGCATCACGGCCCGTAACCTGCGCTGTCTGCACGGAACCGAGGAGAGGAGTTCGACAAGCGCTACGAGAGAGAAGTACTTCAGCCGTGAGGGCAGCATCGATGGCTGGGAGATCCGCAAAGGGCATGAACGATCTGCTGGGCATAACGACATTGCACTGGCCATCAGGTATGCAAGGACAAGTGCGGCGACCAATGGGCATCCCAACCATCGAGGAACTAATTGGCCCTGAAGTCCGTGTACGAGTACGATGCCTAAGCGGAGAACACTATACACGTTACAGCGACACTAGCTAACACTAGCTACCTACTATCCAATGTATTGCAGTAAGGCTACCACACCAGC

Full Affymetrix probeset data:

Annotations for 1639962_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime