FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639963_at:

>probe:Drosophila_2:1639963_at:54:459; Interrogation_Position=2666; Antisense; GATATCCATGTTCCATACATCCGAT
>probe:Drosophila_2:1639963_at:187:193; Interrogation_Position=2700; Antisense; AACTATATTTAGCTGTCGGCGTCGA
>probe:Drosophila_2:1639963_at:168:501; Interrogation_Position=2714; Antisense; GTCGGCGTCGATTTATGTGGCACAA
>probe:Drosophila_2:1639963_at:701:63; Interrogation_Position=2728; Antisense; ATGTGGCACAAAATTCTAAGCGTCA
>probe:Drosophila_2:1639963_at:659:539; Interrogation_Position=2762; Antisense; GGTATTACCATTTTTGCTGGCAATA
>probe:Drosophila_2:1639963_at:230:333; Interrogation_Position=2777; Antisense; GCTGGCAATATCACTCGATTACCTT
>probe:Drosophila_2:1639963_at:247:467; Interrogation_Position=2819; Antisense; GTTGATACATTGGACGCTGACACAT
>probe:Drosophila_2:1639963_at:468:515; Interrogation_Position=2884; Antisense; GTGTCAGTCTTAATGTGTGCGTGTT
>probe:Drosophila_2:1639963_at:6:663; Interrogation_Position=2943; Antisense; TAAACGCAAGGCTTTTGAGCCCTTG
>probe:Drosophila_2:1639963_at:565:637; Interrogation_Position=2969; Antisense; TCGTTGCCACATTCCGCAATCGATA
>probe:Drosophila_2:1639963_at:161:391; Interrogation_Position=3002; Antisense; GAAACGAAACGACCGCATGTAGTTA
>probe:Drosophila_2:1639963_at:421:311; Interrogation_Position=3057; Antisense; GCCAACTAACTATGTTCTGACGTAT
>probe:Drosophila_2:1639963_at:80:247; Interrogation_Position=3100; Antisense; AATTCACTTTCACGCATGAGTTCTT
>probe:Drosophila_2:1639963_at:441:429; Interrogation_Position=3117; Antisense; GAGTTCTTATTGTAATTCTACGCAA

Paste this into a BLAST search page for me
GATATCCATGTTCCATACATCCGATAACTATATTTAGCTGTCGGCGTCGAGTCGGCGTCGATTTATGTGGCACAAATGTGGCACAAAATTCTAAGCGTCAGGTATTACCATTTTTGCTGGCAATAGCTGGCAATATCACTCGATTACCTTGTTGATACATTGGACGCTGACACATGTGTCAGTCTTAATGTGTGCGTGTTTAAACGCAAGGCTTTTGAGCCCTTGTCGTTGCCACATTCCGCAATCGATAGAAACGAAACGACCGCATGTAGTTAGCCAACTAACTATGTTCTGACGTATAATTCACTTTCACGCATGAGTTCTTGAGTTCTTATTGTAATTCTACGCAA

Full Affymetrix probeset data:

Annotations for 1639963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720