FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639968_at:

>probe:Drosophila_2:1639968_at:460:371; Interrogation_Position=1016; Antisense; GAAGGCGCTCACGATCAGGACGTAA
>probe:Drosophila_2:1639968_at:57:291; Interrogation_Position=1036; Antisense; CGTAAACTCGGTGCAGTGGAATCCT
>probe:Drosophila_2:1639968_at:639:591; Interrogation_Position=1062; Antisense; TGGTGGCCGGGCAACTGATATCATG
>probe:Drosophila_2:1639968_at:371:647; Interrogation_Position=1082; Antisense; TCATGCAGCGATGATGGCACCATTA
>probe:Drosophila_2:1639968_at:562:167; Interrogation_Position=639; Antisense; AAATGTTCGCAGAGGAGCCCATAGA
>probe:Drosophila_2:1639968_at:267:407; Interrogation_Position=668; Antisense; GACTGGGATTGCACAGCCACTCTTA
>probe:Drosophila_2:1639968_at:597:643; Interrogation_Position=688; Antisense; TCTTACTTCACACACAAGCACGGTT
>probe:Drosophila_2:1639968_at:178:403; Interrogation_Position=722; Antisense; GACTTCGATGCTGATGGCGAGCGCC
>probe:Drosophila_2:1639968_at:22:481; Interrogation_Position=749; Antisense; GTTTCCTGTAGCGATGACACCACAA
>probe:Drosophila_2:1639968_at:338:589; Interrogation_Position=782; Antisense; TGGAGGGCCTACCATCCCGGAAATA
>probe:Drosophila_2:1639968_at:634:671; Interrogation_Position=887; Antisense; TACGACGTGTCCTGGTGCAAGCTTA
>probe:Drosophila_2:1639968_at:298:79; Interrogation_Position=913; Antisense; AGGTCTGATAGCGACTGCCTGTGGC
>probe:Drosophila_2:1639968_at:5:327; Interrogation_Position=936; Antisense; GCGACGACGGCATTCGTATCTTTAA
>probe:Drosophila_2:1639968_at:144:379; Interrogation_Position=986; Antisense; GAACCCACGTTCGAGCAGATAACCG

Paste this into a BLAST search page for me
GAAGGCGCTCACGATCAGGACGTAACGTAAACTCGGTGCAGTGGAATCCTTGGTGGCCGGGCAACTGATATCATGTCATGCAGCGATGATGGCACCATTAAAATGTTCGCAGAGGAGCCCATAGAGACTGGGATTGCACAGCCACTCTTATCTTACTTCACACACAAGCACGGTTGACTTCGATGCTGATGGCGAGCGCCGTTTCCTGTAGCGATGACACCACAATGGAGGGCCTACCATCCCGGAAATATACGACGTGTCCTGGTGCAAGCTTAAGGTCTGATAGCGACTGCCTGTGGCGCGACGACGGCATTCGTATCTTTAAGAACCCACGTTCGAGCAGATAACCG

Full Affymetrix probeset data:

Annotations for 1639968_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720