FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639970_at:

>probe:Drosophila_2:1639970_at:605:437; Interrogation_Position=2206; Antisense; GAGGACGATGACGACTTCCGGCCAA
>probe:Drosophila_2:1639970_at:646:579; Interrogation_Position=2225; Antisense; GGCCAAACTATCACTACCAGCGCAA
>probe:Drosophila_2:1639970_at:53:241; Interrogation_Position=2250; Antisense; AATCAAGCGCTCTTCCAGAAGCGGC
>probe:Drosophila_2:1639970_at:278:107; Interrogation_Position=2282; Antisense; AGAACAGCTCCACTCAGAGCAGCGA
>probe:Drosophila_2:1639970_at:541:553; Interrogation_Position=2319; Antisense; GGAGCGTGCGGTGATCAACTTTAAC
>probe:Drosophila_2:1639970_at:518:191; Interrogation_Position=2377; Antisense; AACTCGGTGCGGAGGCTTTTCGGCA
>probe:Drosophila_2:1639970_at:568:555; Interrogation_Position=2403; Antisense; GGACGAGGCGCCCTACATCATGGAC
>probe:Drosophila_2:1639970_at:68:105; Interrogation_Position=2432; Antisense; AGACAACGGGCAACCTTGGACGCTA
>probe:Drosophila_2:1639970_at:344:727; Interrogation_Position=2447; Antisense; TTGGACGCTATTTCAACCACTCGTG
>probe:Drosophila_2:1639970_at:249:37; Interrogation_Position=2480; Antisense; ATCTCTTCGTGCAGAACGTGTTCGT
>probe:Drosophila_2:1639970_at:539:513; Interrogation_Position=2497; Antisense; GTGTTCGTGGATACTCACGACCTGC
>probe:Drosophila_2:1639970_at:655:567; Interrogation_Position=2566; Antisense; GGCACCGAGCTGACTTGGAACTACA
>probe:Drosophila_2:1639970_at:23:581; Interrogation_Position=2609; Antisense; TGCCCGGCAAGGTGTTGTACTGCCA
>probe:Drosophila_2:1639970_at:379:717; Interrogation_Position=2657; Antisense; TTCGTCTGCTCTAAGTTCTAGCTTA

Paste this into a BLAST search page for me
GAGGACGATGACGACTTCCGGCCAAGGCCAAACTATCACTACCAGCGCAAAATCAAGCGCTCTTCCAGAAGCGGCAGAACAGCTCCACTCAGAGCAGCGAGGAGCGTGCGGTGATCAACTTTAACAACTCGGTGCGGAGGCTTTTCGGCAGGACGAGGCGCCCTACATCATGGACAGACAACGGGCAACCTTGGACGCTATTGGACGCTATTTCAACCACTCGTGATCTCTTCGTGCAGAACGTGTTCGTGTGTTCGTGGATACTCACGACCTGCGGCACCGAGCTGACTTGGAACTACATGCCCGGCAAGGTGTTGTACTGCCATTCGTCTGCTCTAAGTTCTAGCTTA

Full Affymetrix probeset data:

Annotations for 1639970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720