FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639971_at:

>probe:Drosophila_2:1639971_at:112:3; Interrogation_Position=1009; Antisense; ATCGACACCGTACATTGGTTTCCTT
>probe:Drosophila_2:1639971_at:104:275; Interrogation_Position=1021; Antisense; CATTGGTTTCCTTTTCTGTCTTTAT
>probe:Drosophila_2:1639971_at:208:17; Interrogation_Position=1044; Antisense; ATTTCAGCGTCTTTACCAAGTCCTA
>probe:Drosophila_2:1639971_at:119:53; Interrogation_Position=533; Antisense; ATGCTCGTTACACCCTTTTAGACAA
>probe:Drosophila_2:1639971_at:454:701; Interrogation_Position=548; Antisense; TTTTAGACAACACCTTGCTGCGCTA
>probe:Drosophila_2:1639971_at:175:299; Interrogation_Position=618; Antisense; CGCTCACTCATTGGGACTCTTGAGA
>probe:Drosophila_2:1639971_at:520:403; Interrogation_Position=632; Antisense; GACTCTTGAGAAACGCTGGACCACA
>probe:Drosophila_2:1639971_at:79:271; Interrogation_Position=659; Antisense; CATCGCATCCCGGTAGTCAGGAAAT
>probe:Drosophila_2:1639971_at:713:87; Interrogation_Position=673; Antisense; AGTCAGGAAATCCTGGCCGTGGCCA
>probe:Drosophila_2:1639971_at:177:639; Interrogation_Position=899; Antisense; TTGGCCAACAACTGGTTAGTCGGAT
>probe:Drosophila_2:1639971_at:457:533; Interrogation_Position=926; Antisense; GGTGTTACCAATCCTGCAATTGCAT
>probe:Drosophila_2:1639971_at:582:5; Interrogation_Position=944; Antisense; ATTGCATCACGGTCACGAACTAGGC
>probe:Drosophila_2:1639971_at:283:681; Interrogation_Position=964; Antisense; TAGGCCTCAACCTAGCCAGACTGGT
>probe:Drosophila_2:1639971_at:334:367; Interrogation_Position=996; Antisense; GAATCTCTATTTAATCGACACCGTA

Paste this into a BLAST search page for me
ATCGACACCGTACATTGGTTTCCTTCATTGGTTTCCTTTTCTGTCTTTATATTTCAGCGTCTTTACCAAGTCCTAATGCTCGTTACACCCTTTTAGACAATTTTAGACAACACCTTGCTGCGCTACGCTCACTCATTGGGACTCTTGAGAGACTCTTGAGAAACGCTGGACCACACATCGCATCCCGGTAGTCAGGAAATAGTCAGGAAATCCTGGCCGTGGCCATTGGCCAACAACTGGTTAGTCGGATGGTGTTACCAATCCTGCAATTGCATATTGCATCACGGTCACGAACTAGGCTAGGCCTCAACCTAGCCAGACTGGTGAATCTCTATTTAATCGACACCGTA

Full Affymetrix probeset data:

Annotations for 1639971_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720