FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639972_at:

>probe:Drosophila_2:1639972_at:530:129; Interrogation_Position=105; Antisense; ACCATGGCGCATTAAATCTGAGCTG
>probe:Drosophila_2:1639972_at:299:121; Interrogation_Position=152; Antisense; AGCGAACAAGTGATCCCACCAAGCA
>probe:Drosophila_2:1639972_at:362:261; Interrogation_Position=195; Antisense; CAGGAAAACCTACTTCGGAGTGCCG
>probe:Drosophila_2:1639972_at:85:507; Interrogation_Position=214; Antisense; GTGCCGGAAAGCAAGAGGCCTCTTC
>probe:Drosophila_2:1639972_at:248:719; Interrogation_Position=236; Antisense; TTCCCGATCGGCTGAACATAGTGCT
>probe:Drosophila_2:1639972_at:690:71; Interrogation_Position=275; Antisense; AGGAAAGTGATCTGCCCAAGGGAGT
>probe:Drosophila_2:1639972_at:532:81; Interrogation_Position=293; Antisense; AGGGAGTACTATTGTGCCCCAATCT
>probe:Drosophila_2:1639972_at:62:643; Interrogation_Position=315; Antisense; TCTCGAGACGGCCATGAAGATCCTT
>probe:Drosophila_2:1639972_at:229:495; Interrogation_Position=419; Antisense; GTCACCGGCTGTACATTACCAAAAT
>probe:Drosophila_2:1639972_at:320:351; Interrogation_Position=447; Antisense; GCAGAAGTTCGATTGCGACACCTTT
>probe:Drosophila_2:1639972_at:8:451; Interrogation_Position=480; Antisense; GATCCCTGACAGCTTTCGAGAGGTC
>probe:Drosophila_2:1639972_at:624:9; Interrogation_Position=512; Antisense; ATTCCGACATGCCACTGGGTGTGCA
>probe:Drosophila_2:1639972_at:8:111; Interrogation_Position=74; Antisense; AGAATTTCGGAATCGGCATCAGAGG
>probe:Drosophila_2:1639972_at:508:569; Interrogation_Position=88; Antisense; GGCATCAGAGGCGATCTACCATGGC

Paste this into a BLAST search page for me
ACCATGGCGCATTAAATCTGAGCTGAGCGAACAAGTGATCCCACCAAGCACAGGAAAACCTACTTCGGAGTGCCGGTGCCGGAAAGCAAGAGGCCTCTTCTTCCCGATCGGCTGAACATAGTGCTAGGAAAGTGATCTGCCCAAGGGAGTAGGGAGTACTATTGTGCCCCAATCTTCTCGAGACGGCCATGAAGATCCTTGTCACCGGCTGTACATTACCAAAATGCAGAAGTTCGATTGCGACACCTTTGATCCCTGACAGCTTTCGAGAGGTCATTCCGACATGCCACTGGGTGTGCAAGAATTTCGGAATCGGCATCAGAGGGGCATCAGAGGCGATCTACCATGGC

Full Affymetrix probeset data:

Annotations for 1639972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720