Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639973_a_at:

>probe:Drosophila_2:1639973_a_at:540:627; Interrogation_Position=1001; Antisense; TGCCAGCGGCCTTTTATAACAATTG
>probe:Drosophila_2:1639973_a_at:508:269; Interrogation_Position=1062; Antisense; CATCCTGATGATGCGTGCTACGAAA
>probe:Drosophila_2:1639973_a_at:281:561; Interrogation_Position=1097; Antisense; GGAAAACCTACAAGCTGGCACCTGT
>probe:Drosophila_2:1639973_a_at:73:163; Interrogation_Position=1163; Antisense; AAATGTTTACCTGTGTGCGGTCCCT
>probe:Drosophila_2:1639973_a_at:429:315; Interrogation_Position=595; Antisense; GCCTGTCAAATCTTTTCGTGCCAAA
>probe:Drosophila_2:1639973_a_at:57:507; Interrogation_Position=612; Antisense; GTGCCAAACCAATATGTGCGTCAAT
>probe:Drosophila_2:1639973_a_at:485:161; Interrogation_Position=680; Antisense; AAATACACTTCGATGGTTTGGCCAG
>probe:Drosophila_2:1639973_a_at:589:705; Interrogation_Position=821; Antisense; TTACGTTTCTCATAAGTCTGTCGGT
>probe:Drosophila_2:1639973_a_at:487:539; Interrogation_Position=843; Antisense; GGTATCCATGATATCCAACTGTTTT
>probe:Drosophila_2:1639973_a_at:173:641; Interrogation_Position=867; Antisense; TCTGGCATTTTCCATGACCATGTTC
>probe:Drosophila_2:1639973_a_at:135:57; Interrogation_Position=880; Antisense; ATGACCATGTTCGACTTTGGCACCT
>probe:Drosophila_2:1639973_a_at:349:567; Interrogation_Position=898; Antisense; GGCACCTCTCTAAAACATTTACTCG
>probe:Drosophila_2:1639973_a_at:23:147; Interrogation_Position=918; Antisense; ACTCGGACTTTTGCTATTCATCACA
>probe:Drosophila_2:1639973_a_at:230:655; Interrogation_Position=945; Antisense; TAATTTTTCAATGTGCCGCAGTGGT

Paste this into a BLAST search page for me
TGCCAGCGGCCTTTTATAACAATTGCATCCTGATGATGCGTGCTACGAAAGGAAAACCTACAAGCTGGCACCTGTAAATGTTTACCTGTGTGCGGTCCCTGCCTGTCAAATCTTTTCGTGCCAAAGTGCCAAACCAATATGTGCGTCAATAAATACACTTCGATGGTTTGGCCAGTTACGTTTCTCATAAGTCTGTCGGTGGTATCCATGATATCCAACTGTTTTTCTGGCATTTTCCATGACCATGTTCATGACCATGTTCGACTTTGGCACCTGGCACCTCTCTAAAACATTTACTCGACTCGGACTTTTGCTATTCATCACATAATTTTTCAATGTGCCGCAGTGGT

Full Affymetrix probeset data:

Annotations for 1639973_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime