FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639975_at:

>probe:Drosophila_2:1639975_at:201:67; Interrogation_Position=203; Antisense; ATGGCGGCCGCATGCGTAGTTTCAA
>probe:Drosophila_2:1639975_at:243:391; Interrogation_Position=239; Antisense; GAAACTGGGCCACTTACGTCTATGT
>probe:Drosophila_2:1639975_at:689:277; Interrogation_Position=258; Antisense; CTATGTGCCGGCAACAGCATGTGTT
>probe:Drosophila_2:1639975_at:664:177; Interrogation_Position=302; Antisense; AAACGGAGGCCATTGCTCGTCTGGA
>probe:Drosophila_2:1639975_at:102:501; Interrogation_Position=320; Antisense; GTCTGGAGCCACACTTGGAACTGCA
>probe:Drosophila_2:1639975_at:550:535; Interrogation_Position=384; Antisense; GGTGCTGCAGTACCATCAGATCGAT
>probe:Drosophila_2:1639975_at:603:53; Interrogation_Position=407; Antisense; ATGAATTCTCCCGATCCTTGCAAAG
>probe:Drosophila_2:1639975_at:452:415; Interrogation_Position=496; Antisense; GAGCGAACCAGGACCTTCATTGCTG
>probe:Drosophila_2:1639975_at:593:301; Interrogation_Position=524; Antisense; CCCTGGACGCTGCATTTGTGGAGAA
>probe:Drosophila_2:1639975_at:264:221; Interrogation_Position=578; Antisense; AAGTGATGCTCGACTACCGGCTGCA
>probe:Drosophila_2:1639975_at:82:335; Interrogation_Position=597; Antisense; GCTGCAACAGTTCTATGATCCGGCC
>probe:Drosophila_2:1639975_at:516:137; Interrogation_Position=629; Antisense; ACGTCAGCCTTCTTTGGTGCGTTGG
>probe:Drosophila_2:1639975_at:156:467; Interrogation_Position=649; Antisense; GTTGGCGACCAGGAGACACTGCTTA
>probe:Drosophila_2:1639975_at:636:397; Interrogation_Position=715; Antisense; GACAAACTCTGCCTGGCGGTCAATG

Paste this into a BLAST search page for me
ATGGCGGCCGCATGCGTAGTTTCAAGAAACTGGGCCACTTACGTCTATGTCTATGTGCCGGCAACAGCATGTGTTAAACGGAGGCCATTGCTCGTCTGGAGTCTGGAGCCACACTTGGAACTGCAGGTGCTGCAGTACCATCAGATCGATATGAATTCTCCCGATCCTTGCAAAGGAGCGAACCAGGACCTTCATTGCTGCCCTGGACGCTGCATTTGTGGAGAAAAGTGATGCTCGACTACCGGCTGCAGCTGCAACAGTTCTATGATCCGGCCACGTCAGCCTTCTTTGGTGCGTTGGGTTGGCGACCAGGAGACACTGCTTAGACAAACTCTGCCTGGCGGTCAATG

Full Affymetrix probeset data:

Annotations for 1639975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720