FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639976_at:

>probe:Drosophila_2:1639976_at:651:17; Interrogation_Position=1202; Antisense; ATTTAAGTAGCAGGCGCCGTTCAGC
>probe:Drosophila_2:1639976_at:271:319; Interrogation_Position=1217; Antisense; GCCGTTCAGCAGCAGTGTCATTTAT
>probe:Drosophila_2:1639976_at:590:423; Interrogation_Position=1270; Antisense; GAGAAATCATCATTAGGCACTTGCT
>probe:Drosophila_2:1639976_at:536:29; Interrogation_Position=1284; Antisense; AGGCACTTGCTAAAATTGTACTAAC
>probe:Drosophila_2:1639976_at:48:241; Interrogation_Position=1309; Antisense; AATACCGCAGACATATTGGTGAACG
>probe:Drosophila_2:1639976_at:510:59; Interrogation_Position=1342; Antisense; ATGTTGCCCAATTTACTTGTTTACT
>probe:Drosophila_2:1639976_at:583:149; Interrogation_Position=1356; Antisense; ACTTGTTTACTTTTGTCAGCGGTGG
>probe:Drosophila_2:1639976_at:162:615; Interrogation_Position=1395; Antisense; TGAATTCCCACCAAACATCGGAGCT
>probe:Drosophila_2:1639976_at:10:461; Interrogation_Position=1433; Antisense; GATTTCCTGGTTGATTTCGTTTACA
>probe:Drosophila_2:1639976_at:409:473; Interrogation_Position=1470; Antisense; GTTCATAAGCCGCATGTCTATCAAA
>probe:Drosophila_2:1639976_at:429:413; Interrogation_Position=937; Antisense; GACCAACATTGTTAAGTTACGCAGA
>probe:Drosophila_2:1639976_at:573:473; Interrogation_Position=952; Antisense; GTTACGCAGAGCAAAAAGCCGGGTT
>probe:Drosophila_2:1639976_at:669:181; Interrogation_Position=965; Antisense; AAAAGCCGGGTTACTCATGTCACAT
>probe:Drosophila_2:1639976_at:495:59; Interrogation_Position=981; Antisense; ATGTCACATCAATTTCCAAGCCAAC

Paste this into a BLAST search page for me
ATTTAAGTAGCAGGCGCCGTTCAGCGCCGTTCAGCAGCAGTGTCATTTATGAGAAATCATCATTAGGCACTTGCTAGGCACTTGCTAAAATTGTACTAACAATACCGCAGACATATTGGTGAACGATGTTGCCCAATTTACTTGTTTACTACTTGTTTACTTTTGTCAGCGGTGGTGAATTCCCACCAAACATCGGAGCTGATTTCCTGGTTGATTTCGTTTACAGTTCATAAGCCGCATGTCTATCAAAGACCAACATTGTTAAGTTACGCAGAGTTACGCAGAGCAAAAAGCCGGGTTAAAAGCCGGGTTACTCATGTCACATATGTCACATCAATTTCCAAGCCAAC

Full Affymetrix probeset data:

Annotations for 1639976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720