FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639979_at:

>probe:Drosophila_2:1639979_at:191:381; Interrogation_Position=1009; Antisense; GAACCTATGGCTACGTTGATCCAGA
>probe:Drosophila_2:1639979_at:278:365; Interrogation_Position=1066; Antisense; GAATCAAGTGCGATCCTAACAACCG
>probe:Drosophila_2:1639979_at:167:427; Interrogation_Position=1167; Antisense; GAGATCGACATGACGCAGTTGGGCA
>probe:Drosophila_2:1639979_at:541:319; Interrogation_Position=1207; Antisense; GCCCGAACGGCTTTTACAGGAACTG
>probe:Drosophila_2:1639979_at:369:141; Interrogation_Position=1228; Antisense; ACTGATACTCCCCACAACATATAGT
>probe:Drosophila_2:1639979_at:703:85; Interrogation_Position=1250; Antisense; AGTCCCTTAAGTCAAGCAGCTCGTA
>probe:Drosophila_2:1639979_at:227:207; Interrogation_Position=1263; Antisense; AAGCAGCTCGTAGTTCGTCTTACTT
>probe:Drosophila_2:1639979_at:602:471; Interrogation_Position=1275; Antisense; GTTCGTCTTACTTGTATTCCACTTA
>probe:Drosophila_2:1639979_at:687:319; Interrogation_Position=812; Antisense; GCCGCGTCCCATCATTGATCAAAAT
>probe:Drosophila_2:1639979_at:720:665; Interrogation_Position=841; Antisense; TACAGGACGATCACGTTGACCAGCA
>probe:Drosophila_2:1639979_at:722:479; Interrogation_Position=888; Antisense; GTTTCCCAGACCATTCGCAAGTGGC
>probe:Drosophila_2:1639979_at:695:197; Interrogation_Position=954; Antisense; AACGACGACGGATCTTTCAAGGAGG
>probe:Drosophila_2:1639979_at:643:223; Interrogation_Position=972; Antisense; AAGGAGGAGCTGATCGGCACCGATT
>probe:Drosophila_2:1639979_at:545:567; Interrogation_Position=987; Antisense; GGCACCGATTGCATCACCAAGGGAA

Paste this into a BLAST search page for me
GAACCTATGGCTACGTTGATCCAGAGAATCAAGTGCGATCCTAACAACCGGAGATCGACATGACGCAGTTGGGCAGCCCGAACGGCTTTTACAGGAACTGACTGATACTCCCCACAACATATAGTAGTCCCTTAAGTCAAGCAGCTCGTAAAGCAGCTCGTAGTTCGTCTTACTTGTTCGTCTTACTTGTATTCCACTTAGCCGCGTCCCATCATTGATCAAAATTACAGGACGATCACGTTGACCAGCAGTTTCCCAGACCATTCGCAAGTGGCAACGACGACGGATCTTTCAAGGAGGAAGGAGGAGCTGATCGGCACCGATTGGCACCGATTGCATCACCAAGGGAA

Full Affymetrix probeset data:

Annotations for 1639979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720