FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639981_at:

>probe:Drosophila_2:1639981_at:502:223; Interrogation_Position=114; Antisense; AAGGATTCGTCCTCAGATAGCGATA
>probe:Drosophila_2:1639981_at:446:443; Interrogation_Position=147; Antisense; GATGATCGTATCAAGCCGGCAAGCA
>probe:Drosophila_2:1639981_at:175:169; Interrogation_Position=224; Antisense; AAATGGTGCTACATCTTGGACCCTG
>probe:Drosophila_2:1639981_at:316:35; Interrogation_Position=236; Antisense; ATCTTGGACCCTGGAAGGACTTCGC
>probe:Drosophila_2:1639981_at:486:365; Interrogation_Position=268; Antisense; GAATCAACGAGTTCCGCGGTCGCAA
>probe:Drosophila_2:1639981_at:656:297; Interrogation_Position=282; Antisense; CGCGGTCGCAAATCGGTGGACATTC
>probe:Drosophila_2:1639981_at:35:447; Interrogation_Position=318; Antisense; GATAAGGGCGGCCAAATTCTTCCCG
>probe:Drosophila_2:1639981_at:258:13; Interrogation_Position=333; Antisense; ATTCTTCCCGGCAAGAAGGGCATCT
>probe:Drosophila_2:1639981_at:571:81; Interrogation_Position=349; Antisense; AGGGCATCTCCCTATCTTTAATTCA
>probe:Drosophila_2:1639981_at:361:375; Interrogation_Position=377; Antisense; GAAGAAACTCCTTGAAGTGGCCGAA
>probe:Drosophila_2:1639981_at:86:359; Interrogation_Position=390; Antisense; GAAGTGGCCGAAGAAGTCACCCGCG
>probe:Drosophila_2:1639981_at:92:495; Interrogation_Position=405; Antisense; GTCACCCGCGCGATCGAGAATTAAT
>probe:Drosophila_2:1639981_at:2:5; Interrogation_Position=428; Antisense; ATTGAAGTTCATCCACATGCCAAAC
>probe:Drosophila_2:1639981_at:571:395; Interrogation_Position=50; Antisense; GACAATTTGCGTTTTGTTTCTTCTG

Paste this into a BLAST search page for me
AAGGATTCGTCCTCAGATAGCGATAGATGATCGTATCAAGCCGGCAAGCAAAATGGTGCTACATCTTGGACCCTGATCTTGGACCCTGGAAGGACTTCGCGAATCAACGAGTTCCGCGGTCGCAACGCGGTCGCAAATCGGTGGACATTCGATAAGGGCGGCCAAATTCTTCCCGATTCTTCCCGGCAAGAAGGGCATCTAGGGCATCTCCCTATCTTTAATTCAGAAGAAACTCCTTGAAGTGGCCGAAGAAGTGGCCGAAGAAGTCACCCGCGGTCACCCGCGCGATCGAGAATTAATATTGAAGTTCATCCACATGCCAAACGACAATTTGCGTTTTGTTTCTTCTG

Full Affymetrix probeset data:

Annotations for 1639981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720