FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639982_at:

>probe:Drosophila_2:1639982_at:252:225; Interrogation_Position=101; Antisense; AAGGCGAGGATCTGGCCAGTGCCCA
>probe:Drosophila_2:1639982_at:181:265; Interrogation_Position=124; Antisense; CAGCAAACGCTTGAGGCATCCTTGA
>probe:Drosophila_2:1639982_at:99:439; Interrogation_Position=136; Antisense; GAGGCATCCTTGACCAAATTGGCTG
>probe:Drosophila_2:1639982_at:314:479; Interrogation_Position=15; Antisense; GTTTCTCGCCAAGATTCTAATCCTG
>probe:Drosophila_2:1639982_at:353:161; Interrogation_Position=151; Antisense; AAATTGGCTGCTGGCGAAGGACCCC
>probe:Drosophila_2:1639982_at:209:683; Interrogation_Position=178; Antisense; TATCGCCTCTCCAAAATTCTTTCGG
>probe:Drosophila_2:1639982_at:180:243; Interrogation_Position=192; Antisense; AATTCTTTCGGCAACGTCCCAGGTG
>probe:Drosophila_2:1639982_at:305:631; Interrogation_Position=208; Antisense; TCCCAGGTGGTCTCTGGCTTTAAGA
>probe:Drosophila_2:1639982_at:159:669; Interrogation_Position=238; Antisense; TACTCTGTGGAGCTGATCGATAATC
>probe:Drosophila_2:1639982_at:248:649; Interrogation_Position=261; Antisense; TCAGGGTGCTACCAAGGTGTGCCAA
>probe:Drosophila_2:1639982_at:55:401; Interrogation_Position=289; Antisense; GACATCTGGTCGCAAAGCTGGCTTC
>probe:Drosophila_2:1639982_at:101:583; Interrogation_Position=307; Antisense; TGGCTTCCCAATGGTATCCAGGTGA
>probe:Drosophila_2:1639982_at:532:383; Interrogation_Position=355; Antisense; GAACTGGTCAGGAAACACGATGCTT
>probe:Drosophila_2:1639982_at:235:535; Interrogation_Position=82; Antisense; GGTGCACCAAAAGTCCTCGAAGGCG

Paste this into a BLAST search page for me
AAGGCGAGGATCTGGCCAGTGCCCACAGCAAACGCTTGAGGCATCCTTGAGAGGCATCCTTGACCAAATTGGCTGGTTTCTCGCCAAGATTCTAATCCTGAAATTGGCTGCTGGCGAAGGACCCCTATCGCCTCTCCAAAATTCTTTCGGAATTCTTTCGGCAACGTCCCAGGTGTCCCAGGTGGTCTCTGGCTTTAAGATACTCTGTGGAGCTGATCGATAATCTCAGGGTGCTACCAAGGTGTGCCAAGACATCTGGTCGCAAAGCTGGCTTCTGGCTTCCCAATGGTATCCAGGTGAGAACTGGTCAGGAAACACGATGCTTGGTGCACCAAAAGTCCTCGAAGGCG

Full Affymetrix probeset data:

Annotations for 1639982_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720