FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639983_at:

>probe:Drosophila_2:1639983_at:630:163; Interrogation_Position=102; Antisense; AAATACGGTGTGTGCTCTTGGCAAC
>probe:Drosophila_2:1639983_at:597:645; Interrogation_Position=117; Antisense; TCTTGGCAACAATCAGGACTCCTGT
>probe:Drosophila_2:1639983_at:628:423; Interrogation_Position=15; Antisense; GAGACTTTTCGAGGCGGAAGTTCGC
>probe:Drosophila_2:1639983_at:144:71; Interrogation_Position=153; Antisense; AGGCGGTCCGCTAATCTGTACATAT
>probe:Drosophila_2:1639983_at:513:237; Interrogation_Position=165; Antisense; AATCTGTACATATGGCGGCAAGGAC
>probe:Drosophila_2:1639983_at:86:75; Interrogation_Position=185; Antisense; AGGACTATATCTACGGCCTGGTATC
>probe:Drosophila_2:1639983_at:354:317; Interrogation_Position=200; Antisense; GCCTGGTATCGCACGGACTCACTTG
>probe:Drosophila_2:1639983_at:616:145; Interrogation_Position=216; Antisense; ACTCACTTGCGGCATACCGGGAATG
>probe:Drosophila_2:1639983_at:113:233; Interrogation_Position=237; Antisense; AATGCCCAGCATCTATACAGTGACC
>probe:Drosophila_2:1639983_at:273:643; Interrogation_Position=248; Antisense; TCTATACAGTGACCAGGCCCTATTA
>probe:Drosophila_2:1639983_at:187:269; Interrogation_Position=261; Antisense; CAGGCCCTATTACGATTGGGTCCAA
>probe:Drosophila_2:1639983_at:719:727; Interrogation_Position=276; Antisense; TTGGGTCCAACTACTGATGCAGTCC
>probe:Drosophila_2:1639983_at:2:167; Interrogation_Position=55; Antisense; AAATGCCGCGATATTATAGGACACA
>probe:Drosophila_2:1639983_at:644:703; Interrogation_Position=68; Antisense; TTATAGGACACATCTGGGCGCCACA

Paste this into a BLAST search page for me
AAATACGGTGTGTGCTCTTGGCAACTCTTGGCAACAATCAGGACTCCTGTGAGACTTTTCGAGGCGGAAGTTCGCAGGCGGTCCGCTAATCTGTACATATAATCTGTACATATGGCGGCAAGGACAGGACTATATCTACGGCCTGGTATCGCCTGGTATCGCACGGACTCACTTGACTCACTTGCGGCATACCGGGAATGAATGCCCAGCATCTATACAGTGACCTCTATACAGTGACCAGGCCCTATTACAGGCCCTATTACGATTGGGTCCAATTGGGTCCAACTACTGATGCAGTCCAAATGCCGCGATATTATAGGACACATTATAGGACACATCTGGGCGCCACA

Full Affymetrix probeset data:

Annotations for 1639983_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720