FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639984_at:

>probe:Drosophila_2:1639984_at:83:453; Interrogation_Position=2742; Antisense; GATCTTACATTCTCGTAGCCACATT
>probe:Drosophila_2:1639984_at:505:467; Interrogation_Position=2781; Antisense; GTTTTAAGTCCATCGAACCCACTCT
>probe:Drosophila_2:1639984_at:630:19; Interrogation_Position=2792; Antisense; ATCGAACCCACTCTACATGTAAGCA
>probe:Drosophila_2:1639984_at:629:721; Interrogation_Position=2873; Antisense; TTGCATTTTTCTATCAATCTATCGA
>probe:Drosophila_2:1639984_at:199:685; Interrogation_Position=2892; Antisense; TATCGATCGATCTAAACTCTGAACA
>probe:Drosophila_2:1639984_at:589:143; Interrogation_Position=2907; Antisense; ACTCTGAACATATTTTAAGCCACTT
>probe:Drosophila_2:1639984_at:603:239; Interrogation_Position=2966; Antisense; AATAGCAGCTCGGAATTCCATTTGA
>probe:Drosophila_2:1639984_at:372:9; Interrogation_Position=2980; Antisense; ATTCCATTTGAGGACCGGCGCTTGT
>probe:Drosophila_2:1639984_at:501:287; Interrogation_Position=2995; Antisense; CGGCGCTTGTGCAAGCACTTAGCAT
>probe:Drosophila_2:1639984_at:526:229; Interrogation_Position=3090; Antisense; AATGTCTAACGATTTGCCTCTTCGG
>probe:Drosophila_2:1639984_at:561:315; Interrogation_Position=3105; Antisense; GCCTCTTCGGGTATTGTTCTACACA
>probe:Drosophila_2:1639984_at:690:29; Interrogation_Position=3219; Antisense; ATACTTTTTTGTAGCACGAGATCTA
>probe:Drosophila_2:1639984_at:320:453; Interrogation_Position=3238; Antisense; GATCTACGGGATCTGCGAATGAAAG
>probe:Drosophila_2:1639984_at:593:95; Interrogation_Position=3261; Antisense; AGATACCATACAGGCGGACAATTAT

Paste this into a BLAST search page for me
GATCTTACATTCTCGTAGCCACATTGTTTTAAGTCCATCGAACCCACTCTATCGAACCCACTCTACATGTAAGCATTGCATTTTTCTATCAATCTATCGATATCGATCGATCTAAACTCTGAACAACTCTGAACATATTTTAAGCCACTTAATAGCAGCTCGGAATTCCATTTGAATTCCATTTGAGGACCGGCGCTTGTCGGCGCTTGTGCAAGCACTTAGCATAATGTCTAACGATTTGCCTCTTCGGGCCTCTTCGGGTATTGTTCTACACAATACTTTTTTGTAGCACGAGATCTAGATCTACGGGATCTGCGAATGAAAGAGATACCATACAGGCGGACAATTAT

Full Affymetrix probeset data:

Annotations for 1639984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720