FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639987_at:

>probe:Drosophila_2:1639987_at:203:47; Interrogation_Position=2034; Antisense; ATCCGGACTCTACACACATGATGAA
>probe:Drosophila_2:1639987_at:607:605; Interrogation_Position=2052; Antisense; TGATGAAATCGTGACCTACAACCTG
>probe:Drosophila_2:1639987_at:509:511; Interrogation_Position=2062; Antisense; GTGACCTACAACCTGGAGGCCAGTG
>probe:Drosophila_2:1639987_at:23:189; Interrogation_Position=2160; Antisense; AACAGCGGTGGTGCAGTGTCATCAC
>probe:Drosophila_2:1639987_at:291:611; Interrogation_Position=2264; Antisense; TGACGCCCATGAGGCCGCTGGACAG
>probe:Drosophila_2:1639987_at:128:137; Interrogation_Position=2306; Antisense; ACGACAACATGGGTCGGCGGATCAC
>probe:Drosophila_2:1639987_at:96:405; Interrogation_Position=2342; Antisense; GACTAGGTGGATCCAATCTTTCGCT
>probe:Drosophila_2:1639987_at:452:237; Interrogation_Position=2356; Antisense; AATCTTTCGCTGCACGACGAGGAGC
>probe:Drosophila_2:1639987_at:252:183; Interrogation_Position=2387; Antisense; AAAATGAGACGCTCTTTGGCCAGGC
>probe:Drosophila_2:1639987_at:273:691; Interrogation_Position=2401; Antisense; TTTGGCCAGGCGGAGAGTCAGACCA
>probe:Drosophila_2:1639987_at:190:235; Interrogation_Position=2430; Antisense; AATGCCGGAGCAGTCACAGGATCTT
>probe:Drosophila_2:1639987_at:622:77; Interrogation_Position=2447; Antisense; AGGATCTTCACCAGCCGCAGGAGGT
>probe:Drosophila_2:1639987_at:61:77; Interrogation_Position=2465; Antisense; AGGAGGTGACTCAAGGCCAGGACAA
>probe:Drosophila_2:1639987_at:720:503; Interrogation_Position=2498; Antisense; GTCCTGGCGAGTTCGTGTCGCTCTA

Paste this into a BLAST search page for me
ATCCGGACTCTACACACATGATGAATGATGAAATCGTGACCTACAACCTGGTGACCTACAACCTGGAGGCCAGTGAACAGCGGTGGTGCAGTGTCATCACTGACGCCCATGAGGCCGCTGGACAGACGACAACATGGGTCGGCGGATCACGACTAGGTGGATCCAATCTTTCGCTAATCTTTCGCTGCACGACGAGGAGCAAAATGAGACGCTCTTTGGCCAGGCTTTGGCCAGGCGGAGAGTCAGACCAAATGCCGGAGCAGTCACAGGATCTTAGGATCTTCACCAGCCGCAGGAGGTAGGAGGTGACTCAAGGCCAGGACAAGTCCTGGCGAGTTCGTGTCGCTCTA

Full Affymetrix probeset data:

Annotations for 1639987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720