FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639989_at:

>probe:Drosophila_2:1639989_at:73:21; Interrogation_Position=417; Antisense; ATTTGCACGTGCCTGGAAAGCCTTC
>probe:Drosophila_2:1639989_at:496:357; Interrogation_Position=442; Antisense; GCACACCTTCCGTTGGAGGCCAAGT
>probe:Drosophila_2:1639989_at:364:93; Interrogation_Position=464; Antisense; AGTTCAAGAGTCTCCACTGTACCAA
>probe:Drosophila_2:1639989_at:287:449; Interrogation_Position=497; Antisense; GATCCTATGGCGAAATACTACTGTG
>probe:Drosophila_2:1639989_at:137:241; Interrogation_Position=525; Antisense; AATCAAGGCTATCAATCGGTACAGG
>probe:Drosophila_2:1639989_at:458:217; Interrogation_Position=558; Antisense; AAGTATCCAATTCAGGCAGTTGCGA
>probe:Drosophila_2:1639989_at:33:441; Interrogation_Position=632; Antisense; GATGGCGTCCTTTTCTTTACAATAT
>probe:Drosophila_2:1639989_at:720:185; Interrogation_Position=691; Antisense; AACAATGTGATCGTGAGCCTCGGAT
>probe:Drosophila_2:1639989_at:574:429; Interrogation_Position=718; Antisense; GAGTATCTGAAACCTTACATCCCAA
>probe:Drosophila_2:1639989_at:484:611; Interrogation_Position=743; Antisense; TGACGAACTACACTTGCCCGTTTAA
>probe:Drosophila_2:1639989_at:225:219; Interrogation_Position=784; Antisense; AAGTGTACCGACCTCGAATTTGATA
>probe:Drosophila_2:1639989_at:530:215; Interrogation_Position=814; Antisense; AAGTTCCGTGTTCGATTTCCTATAG
>probe:Drosophila_2:1639989_at:420:281; Interrogation_Position=856; Antisense; CTCCAGTTGAGCTTCATTGTCCAGA
>probe:Drosophila_2:1639989_at:600:609; Interrogation_Position=893; Antisense; TGACCCTAAATGGATCTGCTGAATA

Paste this into a BLAST search page for me
ATTTGCACGTGCCTGGAAAGCCTTCGCACACCTTCCGTTGGAGGCCAAGTAGTTCAAGAGTCTCCACTGTACCAAGATCCTATGGCGAAATACTACTGTGAATCAAGGCTATCAATCGGTACAGGAAGTATCCAATTCAGGCAGTTGCGAGATGGCGTCCTTTTCTTTACAATATAACAATGTGATCGTGAGCCTCGGATGAGTATCTGAAACCTTACATCCCAATGACGAACTACACTTGCCCGTTTAAAAGTGTACCGACCTCGAATTTGATAAAGTTCCGTGTTCGATTTCCTATAGCTCCAGTTGAGCTTCATTGTCCAGATGACCCTAAATGGATCTGCTGAATA

Full Affymetrix probeset data:

Annotations for 1639989_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720