FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639990_at:

>probe:Drosophila_2:1639990_at:8:353; Interrogation_Position=318; Antisense; GCAGAAGACGCTTACAGGCTTGGTA
>probe:Drosophila_2:1639990_at:241:3; Interrogation_Position=333; Antisense; AGGCTTGGTAATGAAGTCCTCTTTA
>probe:Drosophila_2:1639990_at:536:567; Interrogation_Position=398; Antisense; GGCAGTCGGCCCAAAGCGATGTCAA
>probe:Drosophila_2:1639990_at:5:173; Interrogation_Position=461; Antisense; AAAGAGCCCTTGATGAGTCATACGA
>probe:Drosophila_2:1639990_at:48:251; Interrogation_Position=538; Antisense; CAAAACCAATCCTTGCGGGACGAAT
>probe:Drosophila_2:1639990_at:285:371; Interrogation_Position=589; Antisense; GAAGGAGCGACCAGTCTGCCGGCCT
>probe:Drosophila_2:1639990_at:339:411; Interrogation_Position=631; Antisense; GACCCACCGCCCAAATATGAGGAAG
>probe:Drosophila_2:1639990_at:70:405; Interrogation_Position=655; Antisense; GACTATCCCGGACAGCATCATAAAG
>probe:Drosophila_2:1639990_at:266:645; Interrogation_Position=672; Antisense; TCATAAAGCTATGCAGGCCCGGCGC
>probe:Drosophila_2:1639990_at:401:621; Interrogation_Position=697; Antisense; TGCTCCTCTAGCAGTGAATCTGACC
>probe:Drosophila_2:1639990_at:248:367; Interrogation_Position=712; Antisense; GAATCTGACCCCAAGGATGATGATG
>probe:Drosophila_2:1639990_at:190:709; Interrogation_Position=766; Antisense; TTAACCCATAGCCTCATACAAACTG
>probe:Drosophila_2:1639990_at:332:565; Interrogation_Position=819; Antisense; GGAATTGTTGAGATCCCGCTGTCAA
>probe:Drosophila_2:1639990_at:157:495; Interrogation_Position=839; Antisense; GTCAAAGAACAATTCGCGCCAAGTT

Paste this into a BLAST search page for me
GCAGAAGACGCTTACAGGCTTGGTAAGGCTTGGTAATGAAGTCCTCTTTAGGCAGTCGGCCCAAAGCGATGTCAAAAAGAGCCCTTGATGAGTCATACGACAAAACCAATCCTTGCGGGACGAATGAAGGAGCGACCAGTCTGCCGGCCTGACCCACCGCCCAAATATGAGGAAGGACTATCCCGGACAGCATCATAAAGTCATAAAGCTATGCAGGCCCGGCGCTGCTCCTCTAGCAGTGAATCTGACCGAATCTGACCCCAAGGATGATGATGTTAACCCATAGCCTCATACAAACTGGGAATTGTTGAGATCCCGCTGTCAAGTCAAAGAACAATTCGCGCCAAGTT

Full Affymetrix probeset data:

Annotations for 1639990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720