FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639992_at:

>probe:Drosophila_2:1639992_at:258:459; Interrogation_Position=1071; Antisense; GATATTGAACACCAAGTTCTCCAGG
>probe:Drosophila_2:1639992_at:247:179; Interrogation_Position=1132; Antisense; AAAAATCCAGACGATCCGTACCGCA
>probe:Drosophila_2:1639992_at:58:449; Interrogation_Position=1144; Antisense; GATCCGTACCGCATGTTAATCTTAA
>probe:Drosophila_2:1639992_at:600:463; Interrogation_Position=1235; Antisense; GATTGCTTAGTCACCTAGCTTAAAC
>probe:Drosophila_2:1639992_at:610:145; Interrogation_Position=716; Antisense; ACTTTAGCGATCGATCATCCTGGAC
>probe:Drosophila_2:1639992_at:560:43; Interrogation_Position=732; Antisense; ATCCTGGACGAAGACCCCGCAGAGT
>probe:Drosophila_2:1639992_at:454:263; Interrogation_Position=751; Antisense; CAGAGTGAAGCGGATGCTGCTGCAT
>probe:Drosophila_2:1639992_at:528:571; Interrogation_Position=778; Antisense; GGCCCAAAGTCGCTCAGTTCGAAGG
>probe:Drosophila_2:1639992_at:537:65; Interrogation_Position=814; Antisense; ATGGCACAGGTCAAGTACGAACAGC
>probe:Drosophila_2:1639992_at:129:57; Interrogation_Position=845; Antisense; ATGACGAGCAGGAGAGCATGGCCAA
>probe:Drosophila_2:1639992_at:357:377; Interrogation_Position=882; Antisense; GAAGCACAAGCGAGAGGAGTCCCTA
>probe:Drosophila_2:1639992_at:568:549; Interrogation_Position=897; Antisense; GGAGTCCCTAGTGGAGCTACATCAA
>probe:Drosophila_2:1639992_at:581:211; Interrogation_Position=956; Antisense; AAGAACTGGCTGCATCGGGTTCCAA
>probe:Drosophila_2:1639992_at:358:713; Interrogation_Position=975; Antisense; TTCCAAGCCAGAACGAAGACCTTTT

Paste this into a BLAST search page for me
GATATTGAACACCAAGTTCTCCAGGAAAAATCCAGACGATCCGTACCGCAGATCCGTACCGCATGTTAATCTTAAGATTGCTTAGTCACCTAGCTTAAACACTTTAGCGATCGATCATCCTGGACATCCTGGACGAAGACCCCGCAGAGTCAGAGTGAAGCGGATGCTGCTGCATGGCCCAAAGTCGCTCAGTTCGAAGGATGGCACAGGTCAAGTACGAACAGCATGACGAGCAGGAGAGCATGGCCAAGAAGCACAAGCGAGAGGAGTCCCTAGGAGTCCCTAGTGGAGCTACATCAAAAGAACTGGCTGCATCGGGTTCCAATTCCAAGCCAGAACGAAGACCTTTT

Full Affymetrix probeset data:

Annotations for 1639992_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720