FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639993_at:

>probe:Drosophila_2:1639993_at:464:607; Interrogation_Position=1454; Antisense; TGATGGCCATCTTTTCGGTCAGCTT
>probe:Drosophila_2:1639993_at:658:591; Interrogation_Position=1481; Antisense; TGGTGCTCTCCTACATTTTGACGGG
>probe:Drosophila_2:1639993_at:316:37; Interrogation_Position=1507; Antisense; ATCTTTGGTCCGGTGGGCTTCATCT
>probe:Drosophila_2:1639993_at:502:275; Interrogation_Position=1524; Antisense; CTTCATCTTCGCCAACTGCATTAAT
>probe:Drosophila_2:1639993_at:513:349; Interrogation_Position=1556; Antisense; GCAGGATTCTGTACAGCACCTACTA
>probe:Drosophila_2:1639993_at:459:353; Interrogation_Position=1571; Antisense; GCACCTACTACATCAGGCATCAGTA
>probe:Drosophila_2:1639993_at:97:561; Interrogation_Position=1636; Antisense; GGAAAACTCTTTGGATGCACGCTCT
>probe:Drosophila_2:1639993_at:559:569; Interrogation_Position=1669; Antisense; GGCATCGTCTGTTATTGGTACCAAA
>probe:Drosophila_2:1639993_at:673:579; Interrogation_Position=1684; Antisense; TGGTACCAAAGTTCTGACCTTGCCA
>probe:Drosophila_2:1639993_at:94:599; Interrogation_Position=1751; Antisense; TGTCCTGGGCGTTGGCTCATCGAGA
>probe:Drosophila_2:1639993_at:316:41; Interrogation_Position=1775; Antisense; ATCTGGTGCGACTGGCCTGGCGATA
>probe:Drosophila_2:1639993_at:228:681; Interrogation_Position=1798; Antisense; TATGGTCGCCGCATCAAGATCGAAT
>probe:Drosophila_2:1639993_at:494:283; Interrogation_Position=1833; Antisense; CTGTTGGAATTGTTATCCTCGCTTC
>probe:Drosophila_2:1639993_at:86:283; Interrogation_Position=1859; Antisense; CTCGCACCGATGAACCGCAATGAAA

Paste this into a BLAST search page for me
TGATGGCCATCTTTTCGGTCAGCTTTGGTGCTCTCCTACATTTTGACGGGATCTTTGGTCCGGTGGGCTTCATCTCTTCATCTTCGCCAACTGCATTAATGCAGGATTCTGTACAGCACCTACTAGCACCTACTACATCAGGCATCAGTAGGAAAACTCTTTGGATGCACGCTCTGGCATCGTCTGTTATTGGTACCAAATGGTACCAAAGTTCTGACCTTGCCATGTCCTGGGCGTTGGCTCATCGAGAATCTGGTGCGACTGGCCTGGCGATATATGGTCGCCGCATCAAGATCGAATCTGTTGGAATTGTTATCCTCGCTTCCTCGCACCGATGAACCGCAATGAAA

Full Affymetrix probeset data:

Annotations for 1639993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720