FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639994_at:

>probe:Drosophila_2:1639994_at:198:657; Interrogation_Position=1112; Antisense; TAATGCGCAACCTCAAGGCACGCGA
>probe:Drosophila_2:1639994_at:450:277; Interrogation_Position=1174; Antisense; CTTTGCGAGGAGCTACTAGTCCAGA
>probe:Drosophila_2:1639994_at:575:417; Interrogation_Position=1204; Antisense; GAGCTCAAGTCGCAGAATGCCCAGC
>probe:Drosophila_2:1639994_at:583:109; Interrogation_Position=1217; Antisense; AGAATGCCCAGCTGTTGTTAGCCAG
>probe:Drosophila_2:1639994_at:273:475; Interrogation_Position=1233; Antisense; GTTAGCCAGCCAGCATATTTCCGAT
>probe:Drosophila_2:1639994_at:562:687; Interrogation_Position=1248; Antisense; TATTTCCGATTCAAGCACAGCTGCT
>probe:Drosophila_2:1639994_at:202:247; Interrogation_Position=1291; Antisense; AATTGCGAGTCGTCTTCCCGGCAAA
>probe:Drosophila_2:1639994_at:37:233; Interrogation_Position=1323; Antisense; AATGCAGCTACACATTTCCGCACTG
>probe:Drosophila_2:1639994_at:25:563; Interrogation_Position=1350; Antisense; GGAAGCGCTGCGAATCTTTCAGAAA
>probe:Drosophila_2:1639994_at:542:695; Interrogation_Position=1366; Antisense; TTTCAGAAATCAGGCGACTCCAGCT
>probe:Drosophila_2:1639994_at:71:265; Interrogation_Position=1392; Antisense; CAGTTCGGGTCGGTTATAGCACCTA
>probe:Drosophila_2:1639994_at:664:705; Interrogation_Position=1474; Antisense; TTAGGTCGCGTAACATATCCACAAA
>probe:Drosophila_2:1639994_at:304:9; Interrogation_Position=1537; Antisense; ATTGCCATGTTATTGGGCTCATTTA
>probe:Drosophila_2:1639994_at:115:53; Interrogation_Position=1649; Antisense; ATGCTTTGCTCTCTCTCAATTATGA

Paste this into a BLAST search page for me
TAATGCGCAACCTCAAGGCACGCGACTTTGCGAGGAGCTACTAGTCCAGAGAGCTCAAGTCGCAGAATGCCCAGCAGAATGCCCAGCTGTTGTTAGCCAGGTTAGCCAGCCAGCATATTTCCGATTATTTCCGATTCAAGCACAGCTGCTAATTGCGAGTCGTCTTCCCGGCAAAAATGCAGCTACACATTTCCGCACTGGGAAGCGCTGCGAATCTTTCAGAAATTTCAGAAATCAGGCGACTCCAGCTCAGTTCGGGTCGGTTATAGCACCTATTAGGTCGCGTAACATATCCACAAAATTGCCATGTTATTGGGCTCATTTAATGCTTTGCTCTCTCTCAATTATGA

Full Affymetrix probeset data:

Annotations for 1639994_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720