FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639996_at:

>probe:Drosophila_2:1639996_at:673:615; Interrogation_Position=157; Antisense; TGCACCAAGTTCTGTCGATGCGTTG
>probe:Drosophila_2:1639996_at:302:523; Interrogation_Position=226; Antisense; GTGGCCAAGAATTCCAGCGCTGTGA
>probe:Drosophila_2:1639996_at:710:345; Interrogation_Position=308; Antisense; GCATCGATGTCCAGGGCAAGGCGCT
>probe:Drosophila_2:1639996_at:209:653; Interrogation_Position=374; Antisense; TAATGACGCCGCCAAAGTATACCCT
>probe:Drosophila_2:1639996_at:633:89; Interrogation_Position=389; Antisense; AGTATACCCTAGTGGCTGGCAAACC
>probe:Drosophila_2:1639996_at:180:333; Interrogation_Position=403; Antisense; GCTGGCAAACCACCGATGGCTAGTA
>probe:Drosophila_2:1639996_at:300:567; Interrogation_Position=420; Antisense; GGCTAGTAGTCACATTAACCCCATA
>probe:Drosophila_2:1639996_at:200:567; Interrogation_Position=486; Antisense; GGCAGTGAAGCAACCGGCGGAACCT
>probe:Drosophila_2:1639996_at:432:653; Interrogation_Position=521; Antisense; TCAATCTGATCATTCCGGTGCGGCA
>probe:Drosophila_2:1639996_at:235:451; Interrogation_Position=550; Antisense; GATCGCAGGGATCGGAATCTCTTCG
>probe:Drosophila_2:1639996_at:332:367; Interrogation_Position=564; Antisense; GAATCTCTTCGTGCAGCCGGTGAAC
>probe:Drosophila_2:1639996_at:319:523; Interrogation_Position=639; Antisense; GGGCCTGAACGAGCTCCAAGTGTGC
>probe:Drosophila_2:1639996_at:460:221; Interrogation_Position=656; Antisense; AAGTGTGCCAGCTGGTGCTCGAAGA
>probe:Drosophila_2:1639996_at:231:337; Interrogation_Position=672; Antisense; GCTCGAAGAGTTTATGCGCGGCTAC

Paste this into a BLAST search page for me
TGCACCAAGTTCTGTCGATGCGTTGGTGGCCAAGAATTCCAGCGCTGTGAGCATCGATGTCCAGGGCAAGGCGCTTAATGACGCCGCCAAAGTATACCCTAGTATACCCTAGTGGCTGGCAAACCGCTGGCAAACCACCGATGGCTAGTAGGCTAGTAGTCACATTAACCCCATAGGCAGTGAAGCAACCGGCGGAACCTTCAATCTGATCATTCCGGTGCGGCAGATCGCAGGGATCGGAATCTCTTCGGAATCTCTTCGTGCAGCCGGTGAACGGGCCTGAACGAGCTCCAAGTGTGCAAGTGTGCCAGCTGGTGCTCGAAGAGCTCGAAGAGTTTATGCGCGGCTAC

Full Affymetrix probeset data:

Annotations for 1639996_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720