FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639999_at:

>probe:Drosophila_2:1639999_at:637:421; Interrogation_Position=1119; Antisense; GAGAATAACGATCTGCCTGGGCCAG
>probe:Drosophila_2:1639999_at:591:383; Interrogation_Position=1143; Antisense; GAACAGGAATCGCTTTCCTTACGCC
>probe:Drosophila_2:1639999_at:31:317; Interrogation_Position=1165; Antisense; GCCTAACGCCAATCACAGCTGTAGA
>probe:Drosophila_2:1639999_at:173:109; Interrogation_Position=1191; Antisense; AGAAGAAGCCATCCAGTATCAACCT
>probe:Drosophila_2:1639999_at:78:91; Interrogation_Position=1205; Antisense; AGTATCAACCTGGTCCGTGGAACAG
>probe:Drosophila_2:1639999_at:389:79; Interrogation_Position=1228; Antisense; AGGTCGTCCAATTTGTTGCCAAGCG
>probe:Drosophila_2:1639999_at:719:277; Interrogation_Position=1253; Antisense; CTATCCGAAGGAGGCGAACGTGTTC
>probe:Drosophila_2:1639999_at:563:513; Interrogation_Position=1272; Antisense; GTGTTCCGCTACCAGGACATTGATG
>probe:Drosophila_2:1639999_at:281:717; Interrogation_Position=1374; Antisense; TTCGAACTCGTGATGTCCCTGCAGA
>probe:Drosophila_2:1639999_at:308:599; Interrogation_Position=1387; Antisense; TGTCCCTGCAGACTCAATCCAATGA
>probe:Drosophila_2:1639999_at:333:235; Interrogation_Position=1402; Antisense; AATCCAATGACGTTGGCCTCGCCTG
>probe:Drosophila_2:1639999_at:380:113; Interrogation_Position=1456; Antisense; AGCACCTAATGTCATGTACCACACT
>probe:Drosophila_2:1639999_at:540:33; Interrogation_Position=1489; Antisense; ATCAATACTCTCTTCTGTAGCCATC
>probe:Drosophila_2:1639999_at:577:13; Interrogation_Position=1548; Antisense; ATTAAGTCTTCTGGCGGATGGCTAA

Paste this into a BLAST search page for me
GAGAATAACGATCTGCCTGGGCCAGGAACAGGAATCGCTTTCCTTACGCCGCCTAACGCCAATCACAGCTGTAGAAGAAGAAGCCATCCAGTATCAACCTAGTATCAACCTGGTCCGTGGAACAGAGGTCGTCCAATTTGTTGCCAAGCGCTATCCGAAGGAGGCGAACGTGTTCGTGTTCCGCTACCAGGACATTGATGTTCGAACTCGTGATGTCCCTGCAGATGTCCCTGCAGACTCAATCCAATGAAATCCAATGACGTTGGCCTCGCCTGAGCACCTAATGTCATGTACCACACTATCAATACTCTCTTCTGTAGCCATCATTAAGTCTTCTGGCGGATGGCTAA

Full Affymetrix probeset data:

Annotations for 1639999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720