Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640000_at:

>probe:Drosophila_2:1640000_at:712:715; Interrogation_Position=1928; Antisense; TTCGCATCCGTAGTAGGCGGCTGAT
>probe:Drosophila_2:1640000_at:303:227; Interrogation_Position=1966; Antisense; AATGCGAAAGTTCGGCCTTCAGTCA
>probe:Drosophila_2:1640000_at:145:177; Interrogation_Position=1990; Antisense; AAACCCATCATTTCTCTTGAGTCGT
>probe:Drosophila_2:1640000_at:442:87; Interrogation_Position=2009; Antisense; AGTCGTCGTCGTATCTCTATGTGTT
>probe:Drosophila_2:1640000_at:495:481; Interrogation_Position=2041; Antisense; GTATATGTGAAAGCCACCGCCATCG
>probe:Drosophila_2:1640000_at:302:45; Interrogation_Position=2062; Antisense; ATCGCGCTGGCCATTATAGTTCCCT
>probe:Drosophila_2:1640000_at:63:645; Interrogation_Position=2086; Antisense; TCTAGCCGCGACCATTTATCATTGG
>probe:Drosophila_2:1640000_at:162:685; Interrogation_Position=2102; Antisense; TATCATTGGAGGCACTATCCCATTC
>probe:Drosophila_2:1640000_at:213:183; Interrogation_Position=2155; Antisense; AAAACCCATTCGACCAGGCTGGACT
>probe:Drosophila_2:1640000_at:545:365; Interrogation_Position=2280; Antisense; GAATCAGAAGTCGTTGTTGGCCAGT
>probe:Drosophila_2:1640000_at:355:479; Interrogation_Position=2303; Antisense; GTTTGATGGCTGACAACCGCTACAC
>probe:Drosophila_2:1640000_at:565:185; Interrogation_Position=2345; Antisense; AACAGCTAACCGTTGTGGCCAGCAA
>probe:Drosophila_2:1640000_at:307:431; Interrogation_Position=2403; Antisense; GAGTAAACCAGCAGCTACTTGTCTG
>probe:Drosophila_2:1640000_at:297:667; Interrogation_Position=2418; Antisense; TACTTGTCTGCCAAGCTGGTTGGGA

Paste this into a BLAST search page for me
TTCGCATCCGTAGTAGGCGGCTGATAATGCGAAAGTTCGGCCTTCAGTCAAAACCCATCATTTCTCTTGAGTCGTAGTCGTCGTCGTATCTCTATGTGTTGTATATGTGAAAGCCACCGCCATCGATCGCGCTGGCCATTATAGTTCCCTTCTAGCCGCGACCATTTATCATTGGTATCATTGGAGGCACTATCCCATTCAAAACCCATTCGACCAGGCTGGACTGAATCAGAAGTCGTTGTTGGCCAGTGTTTGATGGCTGACAACCGCTACACAACAGCTAACCGTTGTGGCCAGCAAGAGTAAACCAGCAGCTACTTGTCTGTACTTGTCTGCCAAGCTGGTTGGGA

Full Affymetrix probeset data:

Annotations for 1640000_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime