FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640001_at:

>probe:Drosophila_2:1640001_at:564:451; Interrogation_Position=7110; Antisense; GATCGGGTGACGCAAATTCTGCTCA
>probe:Drosophila_2:1640001_at:357:595; Interrogation_Position=7146; Antisense; TGGGCCGAGTTCAAGGATCAGCGAC
>probe:Drosophila_2:1640001_at:720:453; Interrogation_Position=7161; Antisense; GATCAGCGACACGATCTTTTCATCG
>probe:Drosophila_2:1640001_at:39:697; Interrogation_Position=7178; Antisense; TTTCATCGCCGATACTACAATACGT
>probe:Drosophila_2:1640001_at:411:241; Interrogation_Position=7196; Antisense; AATACGTGGCTATCTGACCGGAGTC
>probe:Drosophila_2:1640001_at:233:233; Interrogation_Position=7221; Antisense; AATCCAACGGCTGGGTACCTGACAG
>probe:Drosophila_2:1640001_at:18:399; Interrogation_Position=7241; Antisense; GACAGCGGGTCCTGCGCAAAGCGTA
>probe:Drosophila_2:1640001_at:727:173; Interrogation_Position=7258; Antisense; AAAGCGTAGAAGTTCTCACCTCACC
>probe:Drosophila_2:1640001_at:561:399; Interrogation_Position=7326; Antisense; GACTAGCGACGTGTTATCCGCCGGA
>probe:Drosophila_2:1640001_at:325:55; Interrogation_Position=7392; Antisense; ATGAAGCCTTCGATTGCCACGGAAT
>probe:Drosophila_2:1640001_at:383:701; Interrogation_Position=7472; Antisense; TTTTATTTTGTACACTCGCAGCCAA
>probe:Drosophila_2:1640001_at:46:635; Interrogation_Position=7487; Antisense; TCGCAGCCAATTGTACGTATCGTGA
>probe:Drosophila_2:1640001_at:205:489; Interrogation_Position=7521; Antisense; GTACGGTAATCGTTAGCCAGCATAT
>probe:Drosophila_2:1640001_at:291:725; Interrogation_Position=7610; Antisense; TTGTTAGTTTATACACCGCGCATAA

Paste this into a BLAST search page for me
GATCGGGTGACGCAAATTCTGCTCATGGGCCGAGTTCAAGGATCAGCGACGATCAGCGACACGATCTTTTCATCGTTTCATCGCCGATACTACAATACGTAATACGTGGCTATCTGACCGGAGTCAATCCAACGGCTGGGTACCTGACAGGACAGCGGGTCCTGCGCAAAGCGTAAAAGCGTAGAAGTTCTCACCTCACCGACTAGCGACGTGTTATCCGCCGGAATGAAGCCTTCGATTGCCACGGAATTTTTATTTTGTACACTCGCAGCCAATCGCAGCCAATTGTACGTATCGTGAGTACGGTAATCGTTAGCCAGCATATTTGTTAGTTTATACACCGCGCATAA

Full Affymetrix probeset data:

Annotations for 1640001_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720