FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640002_at:

>probe:Drosophila_2:1640002_at:365:81; Interrogation_Position=1642; Antisense; AGGTGAGTCCCGAGATGGCCAGCAA
>probe:Drosophila_2:1640002_at:57:13; Interrogation_Position=1715; Antisense; ATTCTTCACACGCAATGCACTGGAG
>probe:Drosophila_2:1640002_at:641:221; Interrogation_Position=1761; Antisense; AAGGGCGATCTTAGCCCGAATGTCT
>probe:Drosophila_2:1640002_at:702:369; Interrogation_Position=1778; Antisense; GAATGTCTCACTCATCTTGGGCCAA
>probe:Drosophila_2:1640002_at:154:197; Interrogation_Position=1801; Antisense; AACTGGTTGAGCTTTTCGTCATCGA
>probe:Drosophila_2:1640002_at:436:497; Interrogation_Position=1818; Antisense; GTCATCGATACATTCCTGCGACAGT
>probe:Drosophila_2:1640002_at:77:195; Interrogation_Position=1885; Antisense; AACTGCGCTTCGTGGAGCGTCGCTT
>probe:Drosophila_2:1640002_at:235:581; Interrogation_Position=1921; Antisense; TGGCCAAGCTGCGACCCAATGCGGT
>probe:Drosophila_2:1640002_at:165:337; Interrogation_Position=1947; Antisense; GCTCTGGTGGATGGATTCGATTTTC
>probe:Drosophila_2:1640002_at:389:461; Interrogation_Position=1965; Antisense; GATTTTCACGATCGTGTCCTGGGCT
>probe:Drosophila_2:1640002_at:722:67; Interrogation_Position=2008; Antisense; ATGGCCGGGTGTACGAGCGTCTCAT
>probe:Drosophila_2:1640002_at:178:77; Interrogation_Position=2035; Antisense; AGGAGGCACGCCGAAATCCGATCAA
>probe:Drosophila_2:1640002_at:409:253; Interrogation_Position=2087; Antisense; CAACCACTTGTTGCCCATGATGCGG
>probe:Drosophila_2:1640002_at:146:523; Interrogation_Position=2128; Antisense; GGGCTGGTCTTTTGTTTTCTACATA

Paste this into a BLAST search page for me
AGGTGAGTCCCGAGATGGCCAGCAAATTCTTCACACGCAATGCACTGGAGAAGGGCGATCTTAGCCCGAATGTCTGAATGTCTCACTCATCTTGGGCCAAAACTGGTTGAGCTTTTCGTCATCGAGTCATCGATACATTCCTGCGACAGTAACTGCGCTTCGTGGAGCGTCGCTTTGGCCAAGCTGCGACCCAATGCGGTGCTCTGGTGGATGGATTCGATTTTCGATTTTCACGATCGTGTCCTGGGCTATGGCCGGGTGTACGAGCGTCTCATAGGAGGCACGCCGAAATCCGATCAACAACCACTTGTTGCCCATGATGCGGGGGCTGGTCTTTTGTTTTCTACATA

Full Affymetrix probeset data:

Annotations for 1640002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720