FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640004_at:

>probe:Drosophila_2:1640004_at:157:255; Interrogation_Position=1303; Antisense; CAAACTATGGGATCGGTGGACACTA
>probe:Drosophila_2:1640004_at:86:683; Interrogation_Position=1326; Antisense; TATGAGCCGCATTGGGACAGCTTTC
>probe:Drosophila_2:1640004_at:620:399; Interrogation_Position=1341; Antisense; GACAGCTTTCCCGAAAACCACATTT
>probe:Drosophila_2:1640004_at:32:223; Interrogation_Position=1372; Antisense; AAGGAGATCTACATGGCAACCGAAT
>probe:Drosophila_2:1640004_at:14:253; Interrogation_Position=1399; Antisense; CAACGGGCATTTACTACCTAGCTGA
>probe:Drosophila_2:1640004_at:177:437; Interrogation_Position=1483; Antisense; GAGGAAGCCTTCTCTTTTGGTACAA
>probe:Drosophila_2:1640004_at:629:729; Interrogation_Position=1499; Antisense; TTGGTACAATCTGCATCCCTCTGGA
>probe:Drosophila_2:1640004_at:533:699; Interrogation_Position=1532; Antisense; TTTTCGAACGAAACACGCCGCTTGT
>probe:Drosophila_2:1640004_at:261:729; Interrogation_Position=1553; Antisense; TTGTCCTGTTCTTCAGGGCAGCAAA
>probe:Drosophila_2:1640004_at:557:55; Interrogation_Position=1618; Antisense; ATGTAAGGCCCTGTGATCTCGAAAG
>probe:Drosophila_2:1640004_at:730:283; Interrogation_Position=1659; Antisense; CTGCATTACAGGGACTTCGACTAGA
>probe:Drosophila_2:1640004_at:279:325; Interrogation_Position=1767; Antisense; GCGACTTGTAGCTATCTGAGGTGAG
>probe:Drosophila_2:1640004_at:668:397; Interrogation_Position=1800; Antisense; GACGACGGAACTCCTGGTATCCCGA
>probe:Drosophila_2:1640004_at:258:539; Interrogation_Position=1815; Antisense; GGTATCCCGAGTGCATCCAGATGTT

Paste this into a BLAST search page for me
CAAACTATGGGATCGGTGGACACTATATGAGCCGCATTGGGACAGCTTTCGACAGCTTTCCCGAAAACCACATTTAAGGAGATCTACATGGCAACCGAATCAACGGGCATTTACTACCTAGCTGAGAGGAAGCCTTCTCTTTTGGTACAATTGGTACAATCTGCATCCCTCTGGATTTTCGAACGAAACACGCCGCTTGTTTGTCCTGTTCTTCAGGGCAGCAAAATGTAAGGCCCTGTGATCTCGAAAGCTGCATTACAGGGACTTCGACTAGAGCGACTTGTAGCTATCTGAGGTGAGGACGACGGAACTCCTGGTATCCCGAGGTATCCCGAGTGCATCCAGATGTT

Full Affymetrix probeset data:

Annotations for 1640004_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720