FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640005_at:

>probe:Drosophila_2:1640005_at:279:389; Interrogation_Position=150; Antisense; GAAACAGTACTGCAGAGGCTTCCAA
>probe:Drosophila_2:1640005_at:473:165; Interrogation_Position=173; Antisense; AAATCCTCCACAGCGTCTAAGTGCA
>probe:Drosophila_2:1640005_at:493:11; Interrogation_Position=209; Antisense; ATTCTATCCGAAAATGGCTGCGTGG
>probe:Drosophila_2:1640005_at:283:329; Interrogation_Position=228; Antisense; GCGTGGATCGCGAAAACTTCCTCAA
>probe:Drosophila_2:1640005_at:531:345; Interrogation_Position=356; Antisense; GCATTTGGCTGCTCAAAGCCACTGT
>probe:Drosophila_2:1640005_at:494:257; Interrogation_Position=389; Antisense; CACGTGGACGTAAACCGGGTGCCAG
>probe:Drosophila_2:1640005_at:154:507; Interrogation_Position=407; Antisense; GTGCCAGTTCACCACAGCAGACTAA
>probe:Drosophila_2:1640005_at:264:699; Interrogation_Position=463; Antisense; TTATAAACTCTATCACCACGTGGAA
>probe:Drosophila_2:1640005_at:33:519; Interrogation_Position=521; Antisense; GTGGTAGGACCTCCGATAACTGGAA
>probe:Drosophila_2:1640005_at:492:387; Interrogation_Position=543; Antisense; GAAACAAGCGCCCACGAAAGTACGT
>probe:Drosophila_2:1640005_at:268:393; Interrogation_Position=558; Antisense; GAAAGTACGTATTCTTGCCGGGAAG
>probe:Drosophila_2:1640005_at:107:257; Interrogation_Position=601; Antisense; CACATGTCGGGCTAATGAGGTCCTG
>probe:Drosophila_2:1640005_at:696:369; Interrogation_Position=630; Antisense; GAAGGAATCGCTGCATCCATAGGAA
>probe:Drosophila_2:1640005_at:611:557; Interrogation_Position=651; Antisense; GGAAACGGTTAGCTGGCCAACGACA

Paste this into a BLAST search page for me
GAAACAGTACTGCAGAGGCTTCCAAAAATCCTCCACAGCGTCTAAGTGCAATTCTATCCGAAAATGGCTGCGTGGGCGTGGATCGCGAAAACTTCCTCAAGCATTTGGCTGCTCAAAGCCACTGTCACGTGGACGTAAACCGGGTGCCAGGTGCCAGTTCACCACAGCAGACTAATTATAAACTCTATCACCACGTGGAAGTGGTAGGACCTCCGATAACTGGAAGAAACAAGCGCCCACGAAAGTACGTGAAAGTACGTATTCTTGCCGGGAAGCACATGTCGGGCTAATGAGGTCCTGGAAGGAATCGCTGCATCCATAGGAAGGAAACGGTTAGCTGGCCAACGACA

Full Affymetrix probeset data:

Annotations for 1640005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720