Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640006_at:

>probe:Drosophila_2:1640006_at:156:251; Interrogation_Position=248; Antisense; CAATGGTCTCTACTTCGGAATGGTT
>probe:Drosophila_2:1640006_at:238:701; Interrogation_Position=273; Antisense; TTTTATTATCTCTTCATCGTGGGCA
>probe:Drosophila_2:1640006_at:567:525; Interrogation_Position=293; Antisense; GGGCATTTGCAATCTGCACTGCATA
>probe:Drosophila_2:1640006_at:624:271; Interrogation_Position=314; Antisense; CATAGAAAGCTTTCCCGAGGGCCAT
>probe:Drosophila_2:1640006_at:618:721; Interrogation_Position=363; Antisense; TTGCATGCCGCATATCTGCTGAACA
>probe:Drosophila_2:1640006_at:578:685; Interrogation_Position=462; Antisense; TATCACCACGTGTTCATGTCCTTTG
>probe:Drosophila_2:1640006_at:114:61; Interrogation_Position=477; Antisense; ATGTCCTTTGGAAGTTATGCCCTAA
>probe:Drosophila_2:1640006_at:218:61; Interrogation_Position=526; Antisense; ATGTCAATGCCGTTGGACTGCTGAA
>probe:Drosophila_2:1640006_at:168:535; Interrogation_Position=557; Antisense; GGTGCACACGGTCATGTATTTCTAC
>probe:Drosophila_2:1640006_at:39:687; Interrogation_Position=638; Antisense; TATAACATTGACACAGCTCTGCCAG
>probe:Drosophila_2:1640006_at:537:51; Interrogation_Position=669; Antisense; ATGCTGCTCAGTTATGCCATCTATG
>probe:Drosophila_2:1640006_at:604:697; Interrogation_Position=702; Antisense; TTTTCACCGAATTGTGGCGTTCCAC
>probe:Drosophila_2:1640006_at:195:135; Interrogation_Position=725; Antisense; ACGCGGTCTTCTCTATCTAAATATG
>probe:Drosophila_2:1640006_at:18:685; Interrogation_Position=791; Antisense; TATCGACAACTATCTGAGACCTCCG

Paste this into a BLAST search page for me
CAATGGTCTCTACTTCGGAATGGTTTTTTATTATCTCTTCATCGTGGGCAGGGCATTTGCAATCTGCACTGCATACATAGAAAGCTTTCCCGAGGGCCATTTGCATGCCGCATATCTGCTGAACATATCACCACGTGTTCATGTCCTTTGATGTCCTTTGGAAGTTATGCCCTAAATGTCAATGCCGTTGGACTGCTGAAGGTGCACACGGTCATGTATTTCTACTATAACATTGACACAGCTCTGCCAGATGCTGCTCAGTTATGCCATCTATGTTTTCACCGAATTGTGGCGTTCCACACGCGGTCTTCTCTATCTAAATATGTATCGACAACTATCTGAGACCTCCG

Full Affymetrix probeset data:

Annotations for 1640006_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime