FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640007_at:

>probe:Drosophila_2:1640007_at:280:371; Interrogation_Position=113; Antisense; GAAGGCTGCTGAATCCACTGAGGAG
>probe:Drosophila_2:1640007_at:259:499; Interrogation_Position=145; Antisense; TGTTCGGTGCGCAGCTACGGAAAGC
>probe:Drosophila_2:1640007_at:483:373; Interrogation_Position=177; Antisense; GAAGTTCCTCTACAAAAATGGCCAG
>probe:Drosophila_2:1640007_at:663:433; Interrogation_Position=208; Antisense; GAGGGTATCACCTACTATCCCAGGA
>probe:Drosophila_2:1640007_at:324:177; Interrogation_Position=268; Antisense; AAACTTTTCCGGGTGCAGCGCATCA
>probe:Drosophila_2:1640007_at:359:113; Interrogation_Position=356; Antisense; AGCAGAGCGATTTTACTGTCGTCAA
>probe:Drosophila_2:1640007_at:240:601; Interrogation_Position=423; Antisense; TCTAATTAAGGTTACGCCGGTCACG
>probe:Drosophila_2:1640007_at:724:547; Interrogation_Position=474; Antisense; GGATGTCCGGCATACGATACTCAAG
>probe:Drosophila_2:1640007_at:94:107; Interrogation_Position=500; Antisense; AGAACGGCGAGTGCCTGGTAACCAA
>probe:Drosophila_2:1640007_at:341:581; Interrogation_Position=551; Antisense; TGGCGGCTCGCCAGGATTACGACGA
>probe:Drosophila_2:1640007_at:118:125; Interrogation_Position=578; Antisense; AGCCCAAGCGACTGGATACCGATCT
>probe:Drosophila_2:1640007_at:717:27; Interrogation_Position=593; Antisense; ATACCGATCTGCTGCGCAAAGATGC
>probe:Drosophila_2:1640007_at:646:171; Interrogation_Position=610; Antisense; AAAGATGCCCGCCTCAAGTGGCTAA
>probe:Drosophila_2:1640007_at:185:251; Interrogation_Position=624; Antisense; CAAGTGGCTAAATCCCTGGTAGTTA

Paste this into a BLAST search page for me
GAAGGCTGCTGAATCCACTGAGGAGTGTTCGGTGCGCAGCTACGGAAAGCGAAGTTCCTCTACAAAAATGGCCAGGAGGGTATCACCTACTATCCCAGGAAAACTTTTCCGGGTGCAGCGCATCAAGCAGAGCGATTTTACTGTCGTCAATCTAATTAAGGTTACGCCGGTCACGGGATGTCCGGCATACGATACTCAAGAGAACGGCGAGTGCCTGGTAACCAATGGCGGCTCGCCAGGATTACGACGAAGCCCAAGCGACTGGATACCGATCTATACCGATCTGCTGCGCAAAGATGCAAAGATGCCCGCCTCAAGTGGCTAACAAGTGGCTAAATCCCTGGTAGTTA

Full Affymetrix probeset data:

Annotations for 1640007_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720