FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640010_at:

>probe:Drosophila_2:1640010_at:283:87; Interrogation_Position=232; Antisense; AGTGCCGCGGATTTCGCCAAAGACA
>probe:Drosophila_2:1640010_at:415:157; Interrogation_Position=272; Antisense; ACAACACCTATCTGTACACGAATCC
>probe:Drosophila_2:1640010_at:66:581; Interrogation_Position=317; Antisense; TGGCCAAACAGCTGCAGATCATCTT
>probe:Drosophila_2:1640010_at:559:99; Interrogation_Position=347; Antisense; AGATGTACTCCCAGGTGCAGCTCTA
>probe:Drosophila_2:1640010_at:98:55; Interrogation_Position=422; Antisense; ATGAATCGGACTCATCATCGCCGGA
>probe:Drosophila_2:1640010_at:506:643; Interrogation_Position=499; Antisense; TCATGTACTCCAACCACCGAATGTA
>probe:Drosophila_2:1640010_at:268:389; Interrogation_Position=559; Antisense; GAAACTTCGGAGCAGCAGGAGCCCT
>probe:Drosophila_2:1640010_at:381:329; Interrogation_Position=573; Antisense; GCAGGAGCCCTTTACAACCGAGGAG
>probe:Drosophila_2:1640010_at:233:437; Interrogation_Position=592; Antisense; GAGGAGGACCTTGATCTGCACGCCA
>probe:Drosophila_2:1640010_at:538:291; Interrogation_Position=651; Antisense; CGTCATCCATTTCATTCAACGCATG
>probe:Drosophila_2:1640010_at:319:587; Interrogation_Position=674; Antisense; TGGAGGGCGCCGAGTACTGCAACAA
>probe:Drosophila_2:1640010_at:567:553; Interrogation_Position=699; Antisense; GGAGCTGGAGTTCGACATCTGCAAA
>probe:Drosophila_2:1640010_at:221:373; Interrogation_Position=726; Antisense; GAAGGTGCACACCAAACGCGGCATC
>probe:Drosophila_2:1640010_at:329:347; Interrogation_Position=746; Antisense; GCATCCGTGATTATTTGGCCAGCAA

Paste this into a BLAST search page for me
AGTGCCGCGGATTTCGCCAAAGACAACAACACCTATCTGTACACGAATCCTGGCCAAACAGCTGCAGATCATCTTAGATGTACTCCCAGGTGCAGCTCTAATGAATCGGACTCATCATCGCCGGATCATGTACTCCAACCACCGAATGTAGAAACTTCGGAGCAGCAGGAGCCCTGCAGGAGCCCTTTACAACCGAGGAGGAGGAGGACCTTGATCTGCACGCCACGTCATCCATTTCATTCAACGCATGTGGAGGGCGCCGAGTACTGCAACAAGGAGCTGGAGTTCGACATCTGCAAAGAAGGTGCACACCAAACGCGGCATCGCATCCGTGATTATTTGGCCAGCAA

Full Affymetrix probeset data:

Annotations for 1640010_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720