FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640011_at:

>probe:Drosophila_2:1640011_at:442:259; Interrogation_Position=260; Antisense; CACGTGACGGAGGTTTGCTGGCACT
>probe:Drosophila_2:1640011_at:386:449; Interrogation_Position=298; Antisense; GATCGCCGGAAGTTTGCCATTGCAA
>probe:Drosophila_2:1640011_at:695:209; Interrogation_Position=322; Antisense; AAGAACGACATATCGCCCAACGGCT
>probe:Drosophila_2:1640011_at:340:155; Interrogation_Position=380; Antisense; ACACGGACATCGTTCGGTACTTGGC
>probe:Drosophila_2:1640011_at:105:299; Interrogation_Position=409; Antisense; CGCTTTCCGGAGACCATGACAATTA
>probe:Drosophila_2:1640011_at:72:545; Interrogation_Position=435; Antisense; GGATAATGACGGACGCACGCCGCTT
>probe:Drosophila_2:1640011_at:489:341; Interrogation_Position=456; Antisense; GCTTCATTACGCAGCCACAATTAAG
>probe:Drosophila_2:1640011_at:657:71; Interrogation_Position=479; Antisense; AGGACAACGGCCATTTCTACAACAT
>probe:Drosophila_2:1640011_at:382:665; Interrogation_Position=496; Antisense; TACAACATGCTCCTGCAGTTGGGCG
>probe:Drosophila_2:1640011_at:342:165; Interrogation_Position=529; Antisense; AAATCACTGGACAAGCTGGGCCACT
>probe:Drosophila_2:1640011_at:356:641; Interrogation_Position=553; Antisense; TCGGCCGAGTTTTACCTGGACAAGG
>probe:Drosophila_2:1640011_at:578:177; Interrogation_Position=588; Antisense; AAACATTCTCAACTACACCGAGCTG
>probe:Drosophila_2:1640011_at:112:109; Interrogation_Position=641; Antisense; AGAACCAGTTGCTCAATGACCAGGG
>probe:Drosophila_2:1640011_at:29:97; Interrogation_Position=783; Antisense; AGATAGCGCTATGCCATGCCGCTTT

Paste this into a BLAST search page for me
CACGTGACGGAGGTTTGCTGGCACTGATCGCCGGAAGTTTGCCATTGCAAAAGAACGACATATCGCCCAACGGCTACACGGACATCGTTCGGTACTTGGCCGCTTTCCGGAGACCATGACAATTAGGATAATGACGGACGCACGCCGCTTGCTTCATTACGCAGCCACAATTAAGAGGACAACGGCCATTTCTACAACATTACAACATGCTCCTGCAGTTGGGCGAAATCACTGGACAAGCTGGGCCACTTCGGCCGAGTTTTACCTGGACAAGGAAACATTCTCAACTACACCGAGCTGAGAACCAGTTGCTCAATGACCAGGGAGATAGCGCTATGCCATGCCGCTTT

Full Affymetrix probeset data:

Annotations for 1640011_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720