Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640015_at:

>probe:Drosophila_2:1640015_at:265:151; Interrogation_Position=1263; Antisense; ACATGTCCACGGTACGATTTAAAAG
>probe:Drosophila_2:1640015_at:26:81; Interrogation_Position=1292; Antisense; AGGGAGACTTGCGTAGATGTAGATA
>probe:Drosophila_2:1640015_at:259:443; Interrogation_Position=1307; Antisense; GATGTAGATAGCCATGGATAGCCAA
>probe:Drosophila_2:1640015_at:702:599; Interrogation_Position=1343; Antisense; TGTAGATTGCATAGGCGGCCCACTA
>probe:Drosophila_2:1640015_at:276:277; Interrogation_Position=1365; Antisense; CTATCCAGATCCCACCAAATGTATA
>probe:Drosophila_2:1640015_at:598:203; Interrogation_Position=1389; Antisense; AAGCTAAATCCCCTTTATCATCCAT
>probe:Drosophila_2:1640015_at:333:685; Interrogation_Position=1404; Antisense; TATCATCCATGCAAAACGTTCCAAA
>probe:Drosophila_2:1640015_at:214:181; Interrogation_Position=1426; Antisense; AAAAACAAGCTTTGCGCTCCACTAG
>probe:Drosophila_2:1640015_at:389:623; Interrogation_Position=1438; Antisense; TGCGCTCCACTAGCAAGCAGTTAGC
>probe:Drosophila_2:1640015_at:115:115; Interrogation_Position=1453; Antisense; AGCAGTTAGCTGTCAGTCGAGCAAA
>probe:Drosophila_2:1640015_at:292:703; Interrogation_Position=1595; Antisense; TTATGTTTAGATCGAGGCAAGTAGC
>probe:Drosophila_2:1640015_at:547:25; Interrogation_Position=1679; Antisense; ATAGTACGGACTCCATGTATCCATG
>probe:Drosophila_2:1640015_at:428:231; Interrogation_Position=1739; Antisense; AATGTTTATCTATATGTCCAAGCTA
>probe:Drosophila_2:1640015_at:605:363; Interrogation_Position=1824; Antisense; GAATAAATCCTTTGAAGCACACGTT

Paste this into a BLAST search page for me
ACATGTCCACGGTACGATTTAAAAGAGGGAGACTTGCGTAGATGTAGATAGATGTAGATAGCCATGGATAGCCAATGTAGATTGCATAGGCGGCCCACTACTATCCAGATCCCACCAAATGTATAAAGCTAAATCCCCTTTATCATCCATTATCATCCATGCAAAACGTTCCAAAAAAAACAAGCTTTGCGCTCCACTAGTGCGCTCCACTAGCAAGCAGTTAGCAGCAGTTAGCTGTCAGTCGAGCAAATTATGTTTAGATCGAGGCAAGTAGCATAGTACGGACTCCATGTATCCATGAATGTTTATCTATATGTCCAAGCTAGAATAAATCCTTTGAAGCACACGTT

Full Affymetrix probeset data:

Annotations for 1640015_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime