Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640017_at:

>probe:Drosophila_2:1640017_at:412:191; Interrogation_Position=1043; Antisense; AACTTTTGCAAGTGCGCAACTCCAG
>probe:Drosophila_2:1640017_at:241:297; Interrogation_Position=1069; Antisense; CGCATTCGCAACATCGCGGAGTTGA
>probe:Drosophila_2:1640017_at:46:111; Interrogation_Position=1133; Antisense; AGAATCTCTACCAGGATCGGCAAAA
>probe:Drosophila_2:1640017_at:169:565; Interrogation_Position=1151; Antisense; GGCAAAACGCACACTGGTTGGCACC
>probe:Drosophila_2:1640017_at:172:123; Interrogation_Position=1235; Antisense; AGCGCACACGCAGACGGTTAGCACG
>probe:Drosophila_2:1640017_at:617:473; Interrogation_Position=1251; Antisense; GTTAGCACGCCAATGTTCCTAGGAA
>probe:Drosophila_2:1640017_at:645:47; Interrogation_Position=1298; Antisense; ATCCATTCTACTCACAGAGCGCGAA
>probe:Drosophila_2:1640017_at:643:455; Interrogation_Position=1337; Antisense; GATACATTGAACTCACTTGCATACC
>probe:Drosophila_2:1640017_at:448:431; Interrogation_Position=1391; Antisense; GATCTTTTGAGTTGCCGTAATTTTA
>probe:Drosophila_2:1640017_at:60:415; Interrogation_Position=1425; Antisense; GAGCCAAAATACTCTTCGCTTACAA
>probe:Drosophila_2:1640017_at:647:635; Interrogation_Position=1440; Antisense; TCGCTTACAATTTCTGTTGCTGCAG
>probe:Drosophila_2:1640017_at:471:165; Interrogation_Position=1475; Antisense; AAATCGCCATCATCAACATCGTCGA
>probe:Drosophila_2:1640017_at:392:151; Interrogation_Position=1490; Antisense; ACATCGTCGATAAACCCAGGATCAG
>probe:Drosophila_2:1640017_at:280:243; Interrogation_Position=1541; Antisense; AATTTCAGTTTTGCCCATCATTTAA

Paste this into a BLAST search page for me
AACTTTTGCAAGTGCGCAACTCCAGCGCATTCGCAACATCGCGGAGTTGAAGAATCTCTACCAGGATCGGCAAAAGGCAAAACGCACACTGGTTGGCACCAGCGCACACGCAGACGGTTAGCACGGTTAGCACGCCAATGTTCCTAGGAAATCCATTCTACTCACAGAGCGCGAAGATACATTGAACTCACTTGCATACCGATCTTTTGAGTTGCCGTAATTTTAGAGCCAAAATACTCTTCGCTTACAATCGCTTACAATTTCTGTTGCTGCAGAAATCGCCATCATCAACATCGTCGAACATCGTCGATAAACCCAGGATCAGAATTTCAGTTTTGCCCATCATTTAA

Full Affymetrix probeset data:

Annotations for 1640017_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime