FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640018_at:

>probe:Drosophila_2:1640018_at:409:9; Interrogation_Position=1417; Antisense; ATTCTTACGCCGTACGAGTACTTCG
>probe:Drosophila_2:1640018_at:222:427; Interrogation_Position=1473; Antisense; GAGATTGCATTTGGTTCGGGAACGC
>probe:Drosophila_2:1640018_at:69:381; Interrogation_Position=1492; Antisense; GAACGCATCTACACCCAGCAGTTGG
>probe:Drosophila_2:1640018_at:266:575; Interrogation_Position=1529; Antisense; GGCGTCATTCGCATTTGGTTGGTGT
>probe:Drosophila_2:1640018_at:370:77; Interrogation_Position=1654; Antisense; AGGATAGCCTCCACATCTTATAGCA
>probe:Drosophila_2:1640018_at:48:703; Interrogation_Position=1671; Antisense; TTATAGCACCCTCGATGGCATCGAT
>probe:Drosophila_2:1640018_at:509:569; Interrogation_Position=1687; Antisense; GGCATCGATGGCGACCCGAGTCTAT
>probe:Drosophila_2:1640018_at:716:521; Interrogation_Position=1735; Antisense; GTGGCTCCCGTTCGACAAAATGTAC
>probe:Drosophila_2:1640018_at:14:601; Interrogation_Position=1755; Antisense; TGTACTCTCAATGCGGGAACTGGCT
>probe:Drosophila_2:1640018_at:271:703; Interrogation_Position=1786; Antisense; TTTTGGCTAATCCTCTGGGCGAATC
>probe:Drosophila_2:1640018_at:364:235; Interrogation_Position=1807; Antisense; AATCTTGGAGCGGTGGTTGTCTTCG
>probe:Drosophila_2:1640018_at:545:467; Interrogation_Position=1822; Antisense; GTTGTCTTCGTTCTGGAATTGCTGT
>probe:Drosophila_2:1640018_at:598:169; Interrogation_Position=1887; Antisense; AAAGTCGACGAGAGCCAGTGCCACT
>probe:Drosophila_2:1640018_at:261:171; Interrogation_Position=1992; Antisense; AAAGTGTTCGCTGCTCGTATCGTAA

Paste this into a BLAST search page for me
ATTCTTACGCCGTACGAGTACTTCGGAGATTGCATTTGGTTCGGGAACGCGAACGCATCTACACCCAGCAGTTGGGGCGTCATTCGCATTTGGTTGGTGTAGGATAGCCTCCACATCTTATAGCATTATAGCACCCTCGATGGCATCGATGGCATCGATGGCGACCCGAGTCTATGTGGCTCCCGTTCGACAAAATGTACTGTACTCTCAATGCGGGAACTGGCTTTTTGGCTAATCCTCTGGGCGAATCAATCTTGGAGCGGTGGTTGTCTTCGGTTGTCTTCGTTCTGGAATTGCTGTAAAGTCGACGAGAGCCAGTGCCACTAAAGTGTTCGCTGCTCGTATCGTAA

Full Affymetrix probeset data:

Annotations for 1640018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720