FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640022_at:

>probe:Drosophila_2:1640022_at:597:465; Interrogation_Position=424; Antisense; GATTGGTATCCGAGTCTAGCTATTA
>probe:Drosophila_2:1640022_at:647:29; Interrogation_Position=501; Antisense; ATACAACGATATGCATACCTGACCA
>probe:Drosophila_2:1640022_at:546:33; Interrogation_Position=548; Antisense; ATCAATGTCCTTGGCGTTGTTTGTT
>probe:Drosophila_2:1640022_at:213:661; Interrogation_Position=573; Antisense; TAACCCGGAACATTGAGGCAGACTT
>probe:Drosophila_2:1640022_at:465:265; Interrogation_Position=622; Antisense; CAGATGATCTTGCAGTTTGGCTAAT
>probe:Drosophila_2:1640022_at:238:605; Interrogation_Position=650; Antisense; TGATACATCTTGTTTGGCCAACTCC
>probe:Drosophila_2:1640022_at:197:521; Interrogation_Position=702; Antisense; GGCGGTCTTAATGAAACCTGCCAAG
>probe:Drosophila_2:1640022_at:16:621; Interrogation_Position=756; Antisense; TGCGTAAACTGTCGAGAGAACCTTC
>probe:Drosophila_2:1640022_at:551:17; Interrogation_Position=788; Antisense; ATTTATCATGCGCAACATCCGCAGC
>probe:Drosophila_2:1640022_at:336:633; Interrogation_Position=805; Antisense; TCCGCAGCCTAACCCGAAGATTAAA
>probe:Drosophila_2:1640022_at:372:241; Interrogation_Position=829; Antisense; AATATTACGCCATCCCCAACGAAAG
>probe:Drosophila_2:1640022_at:655:437; Interrogation_Position=896; Antisense; GAGGCTGTATTCTAAACTCTTTTAC
>probe:Drosophila_2:1640022_at:42:209; Interrogation_Position=942; Antisense; AAGCTTTTCACATCATTAATTCCAG
>probe:Drosophila_2:1640022_at:417:67; Interrogation_Position=973; Antisense; ATGGCCAAATTGAGTTGACCTTGTA

Paste this into a BLAST search page for me
GATTGGTATCCGAGTCTAGCTATTAATACAACGATATGCATACCTGACCAATCAATGTCCTTGGCGTTGTTTGTTTAACCCGGAACATTGAGGCAGACTTCAGATGATCTTGCAGTTTGGCTAATTGATACATCTTGTTTGGCCAACTCCGGCGGTCTTAATGAAACCTGCCAAGTGCGTAAACTGTCGAGAGAACCTTCATTTATCATGCGCAACATCCGCAGCTCCGCAGCCTAACCCGAAGATTAAAAATATTACGCCATCCCCAACGAAAGGAGGCTGTATTCTAAACTCTTTTACAAGCTTTTCACATCATTAATTCCAGATGGCCAAATTGAGTTGACCTTGTA

Full Affymetrix probeset data:

Annotations for 1640022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720