Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1640023_s_at:

>probe:Drosophila_2:1640023_s_at:634:289; Interrogation_Position=110; Antisense; CGGACGAGGACGAAGGCCATATCGA
>probe:Drosophila_2:1640023_s_at:588:227; Interrogation_Position=122; Antisense; AAGGCCATATCGAGGATGCTGAGAA
>probe:Drosophila_2:1640023_s_at:554:123; Interrogation_Position=155; Antisense; AGCGCGACCGCGAGAAGCACGACGA
>probe:Drosophila_2:1640023_s_at:689:573; Interrogation_Position=16; Antisense; GGCTGTGGACAGAGCAAGATACATT
>probe:Drosophila_2:1640023_s_at:678:209; Interrogation_Position=169; Antisense; AAGCACGACGAGAGCGAGGAGCTAA
>probe:Drosophila_2:1640023_s_at:606:417; Interrogation_Position=187; Antisense; GAGCTAAGCAATAAGGACATCCAGG
>probe:Drosophila_2:1640023_s_at:170:175; Interrogation_Position=212; Antisense; AAAGCGACGAGGACGTGGCCGTCTC
>probe:Drosophila_2:1640023_s_at:393:75; Interrogation_Position=221; Antisense; AGGACGTGGCCGTCTCACTGCTGCG
>probe:Drosophila_2:1640023_s_at:65:145; Interrogation_Position=237; Antisense; ACTGCTGCGCGCCAAGAACCTATCG
>probe:Drosophila_2:1640023_s_at:321:107; Interrogation_Position=251; Antisense; AGAACCTATCGCTGCTGCAAAGCCA
>probe:Drosophila_2:1640023_s_at:628:455; Interrogation_Position=33; Antisense; GATACATTTGTATCCCAGAAAATCG
>probe:Drosophila_2:1640023_s_at:642:691; Interrogation_Position=39; Antisense; TTTGTATCCCAGAAAATCGAAGAGT
>probe:Drosophila_2:1640023_s_at:587:1; Interrogation_Position=66; Antisense; AGCGAACGGCAAGAAAGGAGGACAT
>probe:Drosophila_2:1640023_s_at:70:317; Interrogation_Position=91; Antisense; GCCGACTCAGATGCCGAAACGGACG

Paste this into a BLAST search page for me
CGGACGAGGACGAAGGCCATATCGAAAGGCCATATCGAGGATGCTGAGAAAGCGCGACCGCGAGAAGCACGACGAGGCTGTGGACAGAGCAAGATACATTAAGCACGACGAGAGCGAGGAGCTAAGAGCTAAGCAATAAGGACATCCAGGAAAGCGACGAGGACGTGGCCGTCTCAGGACGTGGCCGTCTCACTGCTGCGACTGCTGCGCGCCAAGAACCTATCGAGAACCTATCGCTGCTGCAAAGCCAGATACATTTGTATCCCAGAAAATCGTTTGTATCCCAGAAAATCGAAGAGTAGCGAACGGCAAGAAAGGAGGACATGCCGACTCAGATGCCGAAACGGACG

Full Affymetrix probeset data:

Annotations for 1640023_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime